Research Article
Approaching Biomarkers of Membranous Nephropathy from a Murine Model to Human Disease
Table 2
PCR gene sequences in four candidate genes and housekeeping genes.
| Name | Forward | Reverse | Product (bp) |
| Ly6e | 5′agtcttcctgcctgtgctgttg3′ | 5′cgccacaccgagattgagattg3′ | 253 | Lamr-1 | 5′ctcttatgtcaacctgcccacc3′ | 5′tgctcctccttctcaatctcctc3′ | 221 | CtsD | 5′agctgtcctacctgaacgtcac3′ | 5′tgtctttccaccctgcgatacc3′ | 287 | Mt-1 | 5′tcaacgtcctgagtaccttctcc3′ | 5′tgaagacctctgcttcctgtcc3′ | 397 | GAPDH | 5′tccgccccttctgccgatc3′ | 5′cacggaaggccatgccagtga3′ | 354 |
|
|
Ly6e: lymphocyte antigen 6 complex, Lamr-1: laminin receptor-1 (67kDa), CtsD: cathepsin D, Mt-1: metallothionein-1, GAPDH: housekeeping gene, bp: base pair.
|