Combined Effects of Surface Morphology and Mechanical Straining Magnitudes on the Differentiation of Mesenchymal Stem Cells without Using Biochemical Reagents

Table 1

Sequence of PCR primers and product sizes. α-SMA: α-smooth muscle actin, CDM : caldesmon, OPN : osteopontin, BMP2 : bone morphogenic protein-2.

Primer	Forward (F) and reverse (R) primer(5′–3′)	GeneBank accession no.	Product size (bp)
α-SMA	(F) gatgaagcgcagagcaaaag	X60732	231
	(R) catggctgggacattgaaag
CDM	(F) agaggcgatgggagaagaga	AF421381	131
	(R) tttcatcacgagcaacacca
OPN	(F) ctccaatgaatccgacgatg	D16544	388
	(R) cacctggcttacatcatggc
BMP2	(F) cgcctcaaatccagctgtaag	AF041421	79
	(R) gggccacaatccagtcgtt
GAPDH	(F) gtcgtctcctgcgacttcaa	NM_001082253	116
	(R) ccaccaccctgttgctgtag