BioMed Research International / 2013 / Article / Tab 1

Research Article

Development of a Novel Reference Plasmid for Accurate Quantification of Genetically Modified Kefeng6 Rice DNA in Food and Feed Samples

Table 1

Primers and probes used in this study.

TargetPurposePrimer sequence (5′→3′)Amplicon size

Kefeng6ConstructionKF6-1F  GGATCCACGTAGTACGTACCGCCGTG189
KF6-1R  GGATCCAGTGCAGATGCATGAATCGC1
QuantificationKF6-2F  ACGTAGTACGTACCGCCGTG77
KF6-2R  AGTGCAGATGCATGAATCGC
KF6-P  FAM-CCGCGCGTTGTACTGAGAACCA-TAMRA

gos9 Constructiongos9-1F  GGATCCTTAGCCTCCCGCTGCAGA180
gos9-1R  AAGCTTAGAGTCCACAAGTGCTCCCG2
Quantificationgos9-2F  TTAGCCTCCCGCTGCAGA68
gos9-2R  AGAGTCCACAAGTGCTCCCG
gos9-P  FAM-CGGCAGTGTGGTTGGTTTCTTCGG-TAMRA

Kefeng6 and gos9 FusionFusion-F  GGGAGGCTAAGGATCCAGTGCAGATG183
Fusion-R  CATCTGCACTGGATCCTTAGCCTCCC

BamHI site in bold type, 2HindIII site in bold type.

We are committed to sharing findings related to COVID-19 as quickly as possible. We will be providing unlimited waivers of publication charges for accepted research articles as well as case reports and case series related to COVID-19. Review articles are excluded from this waiver policy. Sign up here as a reviewer to help fast-track new submissions.