BioMed Research International / 2013 / Article / Tab 1

Research Article

Gene Silencing of 4-1BB by RNA Interference Inhibits Acute Rejection in Rats with Liver Transplantation

Table 1

Sense and antisense oligomers of shRNA targeting the 4-1BB gene of rats.

shRNA symbolTarget sequenceStart positionshRNA strand

shRNA1
GCTGTTACAAC
ATGGTGGTCA
11
sense
5′-CACCGCTGTTACAACATGGTGGTCATTCAAGAGATGA
CCACCATGTTGTAACAGCTTTTTTG-3′ 
antisense
5′-ACCTTGATTCCAACGGTAACCATCATCTCTTGAAGGA
TACCTTCAAGCATTCCGGAGGATTA-3′

shRNA2
GCAGTAAATAC
CCTCCGGTCT
110sense
5′-CACCGCAGTAAATACCCTCCGGTCTTTCAAGAGAAG
ACCGGAGGGTATTTACTGCTTTTTTG -3′ 
antisense
5′-AACCCCTAGGGCTTAAGCAATCCAGTCTCTTGAACCA
TTTGGCACTTAAGCCATTGACTGAC-3′

shRNA3
GCAGAGTGTGT
CAAGGCTATT
191
sense
5′-CACCGCAGAGTGTGTCAAGGCTATTTCAAGAGAAT
AGCCTTCGAGCACACTCTGCTTTTTTG -3′ 
antisense
5′-AGGTTACCGGGATCCTTGAACAATACTCTTGAACA
ACCCGGTTTACCAAATACCGGAATTGG-3′

shRNANC
ATTGGACCAAG
TGGTTCATAGC
sense
5′-CCTGACGATTAAGGACTAGGTCAGCTTCAAGAGACCC
CTTAAAGCTTTCGGACGTCGCGAAC-3′ 
antisense
5′-AAGTACCAACTACATCTGGGAACTTCTCTTGAAACCC
TGAATGGGTCATCGTAACTACAAC-3′