BioMed Research International / 2013 / Article / Tab 1

Research Article

Biosynthesis of Osmoregulated Periplasmic Glucans in Escherichia coli: The Phosphoethanolamine Transferase Is Encoded by opgE

Table 1

Strains, plasmids, and primers.

Strain, phage, plasmid, or primersRelevant genotype and/or phenotypeSource or reference

Escherichia coli
 JM83ara (lac-pro) thi rpsL 80Δ(lacZ15) [1]
 NFB216JM83 opgH200::Tn10 pyrC46 [2]
 NFB732JM83 opgB214::Tn10 [3]
 NFB775HfrH thi-1 serB28 opgB214::Tn10 dgk-6 relA1 This study
 NFB1887JM83 opgC1::Tn5 This study
 NFB2228JM83 opgB214::Tn10 opgC::Tn5 This study
 NFB4548JM83 opgB214::Tn10 opgC::Tn5 opgE2::cml This study
 NFB4576JM83 opgE2::cml This study
 NFB2231NFB4548/pNF752This study

Phage
NK467b221 c1 857Oam29 Pam8O rex::Tn5 (KanR)N. Kleckner

Plasmids
 pUC18NotAmpR[4]
 pNFCmlAmpR, CmlR[5]
 pKD46AmpR lambda Red recombinase expression[6]

Primer
 Tn5CEcoRIGTGAATTCACTCCGTTCTCTTGCTCGThis study
 Tn5DHindIIIGGGAAAGCTTCCGTTCAGGACGCTACThis study
 foropgECCTGAATTCCCGGTGTTGGTTACCGCTTCThis study
 revopgEGGAAAGCTTATGAATGAGTTCAAGAGGTGThis study
 upopgEGGATCGACGGGATTAGCAAGThis study
 c1TTATACGCAAGGCGACAAGG[6]
 downopgEACGACTGGGCAAGCATCTACThis study
 c2GATCTTCCGTCACAGGTAGG[6]

We are committed to sharing findings related to COVID-19 as quickly and safely as possible. Any author submitting a COVID-19 paper should notify us at help@hindawi.com to ensure their research is fast-tracked and made available on a preprint server as soon as possible. We will be providing unlimited waivers of publication charges for accepted articles related to COVID-19.