Table 1: Primers sequences used for RT-qPCR.

Genes Forwardprimer ( )Reverse primer ( )

EDH4ACCAAGTTCCACTCGCTGAAGCTCATCTCCTCCTGGCTAA
MPTNTTGAAGCCACTGACAACCAGAACAGACAGACAGGCAGCAG
RQCD1GCCAAAGGACAGCAGGAACCAGCGAAAGCCATAAGCAA
ANTXR2CCTCCTCCACCACCACCTTTATCACCCCAACGAACCTC
XISTGGGGTGTTTGACCGTTACATTCCCTCCTTTCACTTTGTCC
RPIIGCACCACGTCCAATGACATGTGCGGCTGCTTCCATAA