Research Article
Improvement of Daptomycin Production in Streptomyces roseosporus through the Acquisition of Pleuromutilin Resistance
Table 2
Primers used for PCR amplification of target genes.
| Primer name | Description | Sequence |
| rplCF | Primes upstream of rplC | GGTGAACAAGCCCCTCAAG | rplCR | Primes downstream of rplC | GGTCAGGTTCTGGGTGGTG | 23rRNAF | Primes upstream of 23S rRNA | AGAGACCAGCGAGAAGCGACT | 23rRNAR | Primes downstream of 23S rRNA | GAACGTAGCCAACCAGCCAT |
|
|