BioMed Research International / 2013 / Article / Tab 1

Research Article

α-Ketoglutarate Accumulation Is Not Dependent on Isocitrate Dehydrogenase Activity during Tellurite Detoxification in Escherichia coli

Table 1

E.  coli strains and primers.

StrainRelevant genotypeReference

BW25113lacIq rrnB ΔlacZ hsdR514 ΔaraBAD ΔrhaBAD [11]
ΔgdhA BW25113 ΔgdhA (gdhA::kan) [11]
ΔicdA BW25113 ΔicdA (icdA::kan) [11]
ΔsodAB DE(lac)4169 rpsL DE(sodA-lacZ)49
DE(sodB-kan)1-DE(2) CamR KanR
[11]
icdApCA24N BW25113 carrying pCA24N[11]

PrimersForward (F) or reverse (R), to amplify5′-3′ sequence

gdhA F F, gdhA CATATTCTCTGGAGTCATTCCTCA
gdhA R R, gdhA ATCATCAACCCA TACCACGC
icdA F F, icdA TCCGGCACAAGGCAAGAAGA
icdA R R, icdA CAGCCAGACGTCCTGACCAT

Article of the Year Award: Outstanding research contributions of 2020, as selected by our Chief Editors. Read the winning articles.