Table 1: Primers used in this study.

SpecificityPrimer sequence (5′-3′)Fragment size (bp)Annealing temperature (°C)References

Tracheal antimicrobial peptide (TAP)F
R
GCGCTCCTCTTCCTGGTCCTG
GCACGTTCTGACTGGGCATTGA
21657[10]
Bovine neutrophil β-defensin 5 (BNBD5)F
R
GCCAGCATGAGGCTCCATC
TTGCCAGGGCACGAGATCG
14355[15]
Lingual antimicrobial peptide (LAP)F
R
GCCAGCATGAGGCTCCATC
CTCCTGCAGCATTTTACTTGGG
19454[15]
Bovine neutrophil β-defensin 10 (BNBD10)F
R
GCTCCATCACCTGCTCCTC
AGGTGCCAATCTGTCTCATGC
15254[11]
Bovine neutrophil β-defensin 4 (BNBD4)F
R
GCCAGCATGAGGCTCCATC
CGTTTAAATTTTAGACGGTGT
27854[15]
Bovine β-defensin 1 (DEFB1)F
R
CCATCACCTGCTCCTCACA
ACCTCCACCTGCAGCATT
18554[11]
Bovine psoriasin (S100A7)F
R
GCAGCTCTCAGCTTGAGCAG
CCAGCAAGGACAGGAACTCAG
22154[11]
Tumor necrosis factor-alpha (TNF-α)F
R
CCCCTGGAGATAACCTCCCA
CAGACGGGAGACAGGAGAGC
10155.5[16]
Glyceraldehyde-3-phosphate dehydrogenase (GAPDH)F
R
TCAACGGGAAGCTCACTGG
CCCCAGCATCGAAGGTAGA
23756.9[17]