BioMed Research International / 2013 / Article / Tab 1

Research Article

The Associated Ion between the VDR Gene Polymorphisms and Susceptibility to Hepatocellular Carcinoma and the Clinicopathological Features in Subjects Infected with HBV

Table 1

The primer sequences of VDR gene polymorphism at 4 loci.

SNPPrimerBase change

FokI5′AGCTGGCCCTGGCACTGACTCTGCTCT3′ (F)C>T61°C
5′ATGGAAACACCTTGCTTCTTCTCCCTC3′ (R)
BsmI5′CAACCAAGACTACAAGTACCGCGTCAGTGA3′ (F)G>A57°C
5′AACCAGCGGGAAGAGGTCAAGGG3′ (R)
ApaI5′CAGAGCATGGACAGGGAGCAA3′ (F)G>T60°C
5′GCAACTCCTCATGGCTGAGGTCTC3′ (R)
TaqI 5′CAGAGCATGGACAGGGAGCAA3′ (F)T>C60°C
5′GCAACTCCTCATGGCTGAGGTCTC3′ (R)