BioMed Research International / 2014 / Article / Tab 1

Research Article

Adipose Tissue-Derived Stem Cell Secreted IGF-1 Protects Myoblasts from the Negative Effect of Myostatin

Table 1

Primer sets for SYBR Green assay.

PrimerTmSequence

Actin 55°CSenseCAGGTCCAGACGCAGGATGGC
AntisenseCTACAATGAGCTGCGTGTGGC

MyoD 57°CSenseGGTCTGGGTTCCCTGTTCTGTGT
AntisenseCCCCGGCGGCAGAATGGCTACG

GAPDH 67°CSenseAGCCACATCGCTCAGACACC
AntisenseGTACTCAGCCGCCAGCATCG

IGF-1 60°CSenseGCTGGTGGAAGCTCTTCAGTTC
AntisenseAGCTGACTTGGCAGGCTTGAG