Research Article
Detection of Food Spoilage and Pathogenic Bacteria Based on Ligation Detection Reaction Coupled to Flow-Through Hybridization on Membranes
Table 1
Nucleotide sequences of the selected unique probes and complementary zipcodes.
| Probe name1 | Probe sequence2 czipcode sequence3 | Pos. |
| Hybrid control | gttaccgctggtgctgccgccggta | 66 | Synth template | agccgcgaacaccacgatcgaccggcgcgcgcagctgcagcttgctcatg | | DS synth template | catgagcaagctgcagctgcgcgcg | | CP synth template | ccggtcgatcgtggtgttcgcggctgtggtgtgccagccgtcggtgccat | 63 | DS Morganella | ggcgtaaagcgcacgcaggcggttgattg | | CP Morganella | agtcagatgtgaaatccccgggcttaacccgggatgtcagtgacgcgctcagcgttg | 29 | DS Shewanella | gatgtctactcggagtttggtgtcttgaacactgggc | | CP Shewanella | tctcaagctaacgcattaagtagaccgcctggggagccgtacccttccgctggagatttac | 23 | DS Aeromonas | gccccgggctcaacctgggaattgcatttaaaactgt | | CP Aeromonas | ccagctagagtcttgtagaggggggtagaattccagtgtgcgcccgagatcggtatccccg | 17 | DS Pseudomonas | cccttgtccttagttaccagcacgtiatggtgggc | | CP Pseudomonas | actctaaggagactgccggtgacaaaccggaggggattgcaccgtcagcaccaccgag | 14 |
|
|
DS: discriminating probe; CP: common probe; 2discriminating positions are indicated as bold; 3complemantary zipcode sequences are underlined.
|