BioMed Research International / 2014 / Article / Tab 1

Research Article

Glioprotective Effects of Ashwagandha Leaf Extract against Lead Induced Toxicity

Table 1

Primer sequences used for semiquantitative RT-PCR.

NumbermRNAPrimer sequenceExpected product size

1GFAPF5′GGC GCT CAA TGC TGG CTT CA3′326 bp
R5′TCT GCC TCC AGC CTC AGG TT3′

2HSP70F5′GAG TTC AAG CGC AAA CAC AA3′428 bp
R5′CTC AGA CTT GTC GCC AAT GA3′

3NCAMF5′GCC AAG GAG AAA TCA GCG TTG GAG AGT C3′651 bp
R5′ATG CTC TTC AGG GTC AAG GAG GAC ACA C3′

4MortalinF5′CAG TCT TCT GGT GGA TTA AG3′420 bp
R5′ATT AGC ACC GTC ACG TAA CAC CTC3′

5 -ActinF 5′TCACCCACACTGTGCCCATCTACGA3′285 bp
R 5′CAGCGGAACCGCTCATTGCCAATGG3′

Article of the Year Award: Outstanding research contributions of 2020, as selected by our Chief Editors. Read the winning articles.