|
Primers | Gene | Molecules | Reference | PCR programs |
|
pA: AGAGTTTGATCCTGGCTCAG pH: AAGGAGGTGATCCAGCCGCA 1,5 Kb | 16S RNA | /////////// | [28] | PCR cycles were as follows: 1 cycle at 95°C for 10 min; 35 cycles at 94°C for 1 min, 55°C for 1 min, and 72°C for 2 min; one final cycle at 72°C for 10 min. |
|
Glu1: CSGGSGSSGCSGGSTTCATSGG Glu2: GGGWRCTGGYRSGGSCCGTAGTTG 546 bp | dNDP-Glucose-4,6-dehydratases | ////// | [29] | PCR conditions used were 95°C for 4 min; 30 cycles of 95°C for 30 s, 65°C for 30 s, and 68°C for 1.30 min; and a final extension cycle at 68°C for 5 min. |
|
StaDVF: GTSATGMTSCAGTACCTSTACGC StaDVR: YTCVAGCTGRTAGYCSGGRTG. 570 bp | Oxytryptophan dimerization genes (StaD/RebD/VioB) (indolotryptoline biosynthetic gene cluster) | BE-54017, (tryptophan dimmers) | [30] | PCR protocol: 1 cycle of 95°C for 5 min; 7 cycles of 95°C for 30 sec, 65°C for 30 sec with 1°C decrement per cycle to 59°C, and 72°C for 40 sec; 30 cycles of 95°C for 30 sec, 58°C for 30 sec, and 72°C for 40 sec; 1 cycle of 72°C for 7 min; hold at 4°C |
|
AuF3: GAACTGGCCSCGSRTBTT AuR4: CCNGTGTGSARSKTCATSA 600–700 bp | Iadomycin cyclase gene of Streptomyces venezuelae ISP5230 | Angucycline cyclases Marine sponge | [31] | Optimized PCR conditions were as follows: (1) denaturation at 94°C for 5 min, (2) 30 amplification cycles with denaturation (45 s, 94°C), annealing (60 s, 60°C), and extension (60 s, 72°C), and (3) a final extension at 72°C for 8 min. |
|