miRSeq: A User-Friendly Standalone Toolkit for Sequencing Quality Evaluation and miRNA Profiling

Table 2

Alignment results of readPro. The small RNA NGS data of eight libraries were analyzed with miRSeq. Raw reads were classified into clean, nonclean, or self-ligation after 3′ adaptor trimming step. The clean reads following specified criteria are classified as qualified reads for further analysis. The sequences of adaptors 1, 2, and 3 are TGGAATTCTCGGGTGCCAAGG, TCGTATGCCGTCTTCTGCTTG, and ATCTCGTATGCCGTCTTCTGCTTG, respectively. The sequence of adaptor C (CTGTAGGCACCATCAATCGT) is based on the information in the corresponding SRA page.

Library	All	Self-ligation	Nonclean	Clean	Qualified	Adaptor version
L1	11,229,160	0.72%	4.65%	94.62%	86.15%	Adaptor 1
L2	11,501,087	0.02%	3.34%	96.65%	86.12%	Adaptor 1
L3	6,314,030	0.04%	3.94%	96.02%	85.37%	Adaptor 1
L4	6,235,528	0.03%	3.71%	96.26%	87.98%	Adaptor 1
L5	22,634,033	15.08%	7.59%	77.33%	68.37%	Adaptor 2
L6	9,023,339	0.23%	3.73%	96.04%	74.08%	Adaptor 1
L7	10,314,488	0.00%	13.61%	86.39%	83.08%	Adaptor C
L8	22,435,248	1%	7%	92%	83%	Adaptor 3