BioMed Research International / 2014 / Article / Tab 1

Research Article

Hyperuricemic PRP in Tendon Cells

Table 1

Real-time PCR primers used in this study.

GeneForward primer (5′→3′)Reverse primer (5′→3′) (°C)

SCXCAGCCCAAACAGATCTGCACCTTCTGTCTTTCTGTCGCGGTCCTT58
DCNGGTGGGCTGGCAGAGCATAAGTTGTCCAGGTGGGCAGAAGTCA58
TNMDGAAGCGGAAATGGCACTGATGATGAAGACCCACGAAGTAGATGCCA60
COMPCCGACAGCAACGTGGTCTTCAGGTTGGCCCAGATGATG55
ACANACAGCTGGGGACATTAGTGGGTGGAATGCAGAGGTGGTTT55
SOX9AGCGAACGCACATCAAGACGCTGTAGTGTGGGAGGTTGAA55
COL1A1GGCAACAGCCGCTTCACCTACGCGGGAGGACTTGGTGGTTTT58
COL3A1CACGGAAACACTGGTGGACAGATTATGCCAGCTGCACATCAAGGAC58
COL2A1AACCAGATTGAGAGCATCCGAACGTTTGCTGGATTGGGGT55
HAS2GTCCCG GTGAGACAGATGAGATGAGGCTGGGTCAAGCATAG58
IL-1bTCCAAGGGGACAGGATATGGAGCAAGGCCCAAGGCCACAGGTATTT58
IL-6GAGGCACTGGCAGAAAACAACCCCTCAAACTCCAAAAGACCAGTGATG58
IL-8CTGTCTGGACCCCAAGGAAAACTGCAACCCTACAACAGACCCACAC57
COX1GGTTTGGCATGAAACCCTACACCTCCTCCAACTCTGCTGCCATCT58
COX2AACTGCGCCTTTTCAAGGATGGTGCTCAGGGACTTGAGGAGGGT58
TGF-beta1GAGGTCACCCGCGTGCTAATGCACGGGTTCAGGTACCGCTTCT58
GAPDHGCATTGCCCTCAACGACCACTCCATGAGGTCCACCACCCTGT58
TBPTGCACAGGAGCCAAGAGTGAACACATCACAGCTCCCCACCA58

Scleraxis (SCX), decorin (DCN), tenomodulin (TNMD), cartilage oligomeric protein (COMP), aggrecan (ACAN), SRY (sex determining region Y)-box 9 (SOX9), collagen type I alpha 1 (COL1A1), collagen type 3 alpha 1 (COL3A1), collagen type II alpha 1 (COL2A1), hyaluronan synthase 2 (HAS2), interleukin 1, beta (IL-1b), interleukin-6 (IL-6), interleukin-8 (IL-8), cytochrome c oxidase 1 (COX1), cytochrome c oxidase 2 (COX2), glyceraldehyde 3-phosphate dehydrogenase (GAPDH), and TATA box binding protein (TBP).