BioMed Research International / 2014 / Article / Tab 1

Research Article

The Role of PinX1 in Growth Control of Breast Cancer Cells and Its Potential Molecular Mechanism by mRNA and lncRNA Expression Profiles Screening

Table 1

Primers used for real-time RT-PCR.

mRNAs/lncRNAsForward primer (5′-3′)Reverse primer (5′-3′)

PinX1CCAGAGGAGAACGAAACCACGACCTGCGTCTCAGAAATGTCA
CUL2CATGTTCGGCATTTGCATAAGAGGCACCCTTGCTGTATTCTTCC
HIF1ACACCACAGGACAGTACAGGATCGTGCTGAATAATACCACTCACA
RETACACGGCTGCATGAGAACAAGCCCTCACGAAGGGATGTG
JAK1CTTTGCCCTGTATGACGAGAACACCTCATCCGGTAGTGGAGC
STAT1CGGCTGAATTTCGGCACCTCAGTAACGATGAGAGGACCCT
BCL-2GGTGGGGTCATGTGTGTGGCGGTTCAGGTACTCAGTCATCC
RP11-124O11.2TGCACCCATGATGAGGAAATCTGAAGAGGTAAGCCCTTTGT
lincRNA-TMEM30B-1CCGACTTGGTATCGACAACTTCAGCATAGAGGTCTCCTGTTTC
GAPDHCTGGGCTACACTGAGCACCAAGTGGTCGTTGAGGGCAATG

We are committed to sharing findings related to COVID-19 as quickly as possible. We will be providing unlimited waivers of publication charges for accepted research articles as well as case reports and case series related to COVID-19. Review articles are excluded from this waiver policy. Sign up here as a reviewer to help fast-track new submissions.