MALDI-TOF Mass Array Analysis of <i>Nell-1</i> Promoter Methylation Patterns in Human Gastric Cancer

<table class="table-group" id="tab2"><tr><td><table class="table"><tr><td class="thead-hr" colspan="3"><hr/></td></tr><tr class="thead"><td align="left">Human gene </td><td align="center">Forward primer sequence (<svg height="13.7564pt" id="M3" style="vertical-align:-2.1898pt" version="1.1" viewbox="-0.0498162 -11.5666 49.751 13.7564" width="49.751pt" xmlns="http://www.w3.org/2000/svg" xmlns:xlink="http://www.w3.org/1999/xlink"><g transform="matrix(.013,0,0,-0.013,0,0)"><path d="M158 548H390L417 615L410 623H122L83 318C105 326 143 337 185 337C296 337 350 275 350 188C350 116 308 42 225 42C164 42 122 74 100 93C90 101 82 99 72 92C60 82 51 68 50 59C48 46 52 38 66 24C82 9 125 -12 172 -12C225 -11 292 15 346 59C408 108 437 166 437 226C437 309 371 397 242 397C214 397 170 382 133 369L158 548Z" id="g50-54"></path><glyph.data ascent="3443" descent="-2856" horiz-adv-x="487" vert-adv-y="487"></glyph.data></g><g transform="matrix(.0091,0,0,-0.0091,6.331,-5.872)"><path d="M310 541L304 571C290 586 211 619 185 610L80 76L131 52L310 541Z" id="g50-31"></path><glyph.data ascent="3443" descent="-2856" horiz-adv-x="361" vert-adv-y="361"></glyph.data></g><g transform="matrix(.013,0,0,-0.013,16.007,0)"><path d="M935 263C895 299 821 372 745 456L719 439L824 289H72V236H823L719 87L745 70C821 154 895 227 935 263Z" id="g54-148"></path><glyph.data ascent="3443" descent="-2856" horiz-adv-x="990" vert-adv-y="990"></glyph.data></g><g transform="matrix(.013,0,0,-0.013,34.758,0)"><path d="M290 377C321 398 342 415 358 430C378 450 389 473 389 502C389 578 329 635 238 635H237C184 635 137 610 109 578L64 515L88 493C112 529 154 573 208 573S303 542 303 482C303 409 233 370 141 341L149 308C165 313 190 319 215 319C272 319 341 283 341 193C342 98 292 43 222 43C163 43 122 72 96 94C88 101 79 100 70 94C61 87 47 73 46 60C44 47 48 37 62 23C76 10 118 -12 165 -12C238 -12 430 62 430 223C430 297 379 359 290 375V377Z" id="g50-52"></path><glyph.data ascent="3443" descent="-2856" horiz-adv-x="487" vert-adv-y="487"></glyph.data></g><g transform="matrix(.0091,0,0,-0.0091,41.089,-5.872)"><path d="M310 541L304 571C290 586 211 619 185 610L80 76L131 52L310 541Z" id="g50-31"></path><glyph.data ascent="3443" descent="-2856" horiz-adv-x="361" vert-adv-y="361"></glyph.data></g><g transform="matrix(.013,0,0,-0.013,44.885,0)"><path d="M283 271C283 451 220 610 70 710L48 683C146 603 207 443 207 271S149 -59 48 -142L70 -169C220 -67 283 90 283 271Z" id="g50-42"></path><glyph.data ascent="3443" descent="-2856" horiz-adv-x="358" vert-adv-y="358"></glyph.data></g></svg></td><td align="center">Reverse primer sequence (<svg height="11.773pt" id="M4" style="vertical-align:-0.2063999pt" version="1.1" viewbox="-0.0498162 -11.5666 45.0795 11.773" width="45.0795pt" xmlns="http://www.w3.org/2000/svg" xmlns:xlink="http://www.w3.org/1999/xlink"><g transform="matrix(.013,0,0,-0.013,0,0)"><path d="M158 548H390L417 615L410 623H122L83 318C105 326 143 337 185 337C296 337 350 275 350 188C350 116 308 42 225 42C164 42 122 74 100 93C90 101 82 99 72 92C60 82 51 68 50 59C48 46 52 38 66 24C82 9 125 -12 172 -12C225 -11 292 15 346 59C408 108 437 166 437 226C437 309 371 397 242 397C214 397 170 382 133 369L158 548Z" id="g50-54"></path><glyph.data ascent="3443" descent="-2856" horiz-adv-x="487" vert-adv-y="487"></glyph.data></g><g transform="matrix(.0091,0,0,-0.0091,6.331,-5.872)"><path d="M310 541L304 571C290 586 211 619 185 610L80 76L131 52L310 541Z" id="g50-31"></path><glyph.data ascent="3443" descent="-2856" horiz-adv-x="361" vert-adv-y="361"></glyph.data></g><g transform="matrix(.013,0,0,-0.013,16.007,0)"><path d="M935 263C895 299 821 372 745 456L719 439L824 289H72V236H823L719 87L745 70C821 154 895 227 935 263Z" id="g54-148"></path><glyph.data ascent="3443" descent="-2856" horiz-adv-x="990" vert-adv-y="990"></glyph.data></g><g transform="matrix(.013,0,0,-0.013,34.758,0)"><path d="M290 377C321 398 342 415 358 430C378 450 389 473 389 502C389 578 329 635 238 635H237C184 635 137 610 109 578L64 515L88 493C112 529 154 573 208 573S303 542 303 482C303 409 233 370 141 341L149 308C165 313 190 319 215 319C272 319 341 283 341 193C342 98 292 43 222 43C163 43 122 72 96 94C88 101 79 100 70 94C61 87 47 73 46 60C44 47 48 37 62 23C76 10 118 -12 165 -12C238 -12 430 62 430 223C430 297 379 359 290 375V377Z" id="g50-52"></path><glyph.data ascent="3443" descent="-2856" horiz-adv-x="487" vert-adv-y="487"></glyph.data></g><g transform="matrix(.0091,0,0,-0.0091,41.089,-5.872)"><path d="M310 541L304 571C290 586 211 619 185 610L80 76L131 52L310 541Z" id="g50-31"></path><glyph.data ascent="3443" descent="-2856" horiz-adv-x="361" vert-adv-y="361"></glyph.data></g></svg>)</td></tr><tr><td class="thead-hr" colspan="3"><hr/></td></tr><tr><td align="left"><i>Nell-1 </i></td><td align="center">GCTTTGGGATGGACCCTGAC</td><td align="center">GAAATAAAAATGCTTTGCTGGC</td></tr><tr><td align="left">GAPDH</td><td align="center">GTCTCCTCTGACTTCAACAGCG </td><td align="center">ACCACCCTGTTGCTGTAGCC</td></tr><tr class="table-tr"><td colspan="3"><hr class="tbody-hr"/></td></tr></table></td></tr></table>

The primer sequences of <i>Nell-1</i> and GAPDH genes.

BioMed Research International

tab2

Table 2

Table 2: MALDI-TOF Mass Array Analysis of <i>Nell-1</i> Promoter Methylation Patterns in Human Gastric Cancer 

BioMed Research International

MALDI-TOF Mass Array Analysis of Nell-1 Promoter Methylation Patterns in Human Gastric Cancer

Table 2