BioMed Research International / 2015 / Article / Tab 2

Research Article

Effect of Dietary Lead on Intestinal Nutrient Transporters mRNA Expression in Broiler Chickens

Table 2

Primer sequences () used in real-time PCR.

NameForward primerReverse primerProduct size (bp)Annealing
Temperature °C

SODAGGGGGTCATCCACTTCCCCCATTTGTGTTGTCTCCAA12262.1
CATGGGGAGCTGTTTACTGCAAGTTTCCATTGGCTATGGCATT13960
GSTαGCCTGACTTCAGTCCTTGGTCCACCGAATTGACTCCATCT13162.1
Hsp70AACCGCACCACACCCAGCTATGCTGGGAGTCGTTGAAGTAAGCG35965
IL2TGCAGTGTTACCTGGGAGAACTTGCATTCACTTCCGGTGT13560.2
IL6GACTCGTCCGGAGAGGTTGCGCACACGGTGAACTTCTT12860.2
SGLT1TGTCTCTCTGGCAAGAACATGTCGGGCAAGAGCTTCAGGTATCC22960.2
SGLT5ATACCCAAGGTAATAGTCCCAAACTGGGTCCCTGAACAAATGAAA7560
GLUT2CACACTATGGGCGCATGCTATTGTCCCTGGAGGTGTTGGTG11660
GLUT5TTGCTGGCTTTGGGTTGTGGGAGGTTGAGGGCCAAAGTC9960
PepT1CCCCTGAGGAGGATCACTGTTCAAAAGAGCAGCAGCAACGA20560
EAAT3TGCTGCTTTGGATTCCAGTGTAGCAATGACTGTAGTGCAGAAGTAATATATG7960
GAPDHGCCGTCCTCTCTGGCAAAGTGTAAACCATGTAGTTCAGATCGATGA12860
B-actinATGAAGCCCAGAGCAAAAGAGGGGTGTTGAAGGTCTCAAA17560

SOD (superoxide dismutase); CAT (catalase); GST-α (3-glutathione S-transferase-α); Hsp70 (heat shock protein); IL2 (interleukin 2); IL6 (interleukin 6); SGLT1 (Na+-dependent glucose and galactose transporter); SGLT5 (glucose transporter); GLUT2 (Na+-independent glucose, galactose and fructose transporter); GLUT5 (Na+-independent fructose transporter); PepT1 (oligopeptide transporter); EAAT3 (excitatory amino acid transporter 3, Na+, H+, K+ dependent); GAPDH (glyceraldehyde phosphate dehydrogenase).