BioMed Research International / 2015 / Article / Tab 1

Research Article

Identification, Characterization, and Developmental Expression Pattern of Type III Interferon Receptor Gene in the Chinese Goose

Table 1

The list of primers.

Primer nameSequence 5′-3′Application

Oligo(dT)18TTTTTTTTTTTTTTTTTTReverse transcription
IFNLR1-1FACATGG(A/G)C(T/G)CC(A/G)GGAGAAGGDegenerate PCR
IFNLR1-1RTCTTGTCTTCAGA(T/C)CC(G/A/T/C)GCDegenerate PCR
IFNLR1-5G0AGGCGGCATTCAC5RACE PCR
IFNLR1-5GSP1AGCCAGTTCCACATCCAAAT5RACE PCR
IFNLR1-5GSP2TCCTGGCTTTCATACCTCAC5RACE PCR
5RACE-AAPGGCCACGCGTCGACTACGGGIIGGGIIGG 
GIIGGGIIG
5RACE PCR
5RACE-AUAPGGCCACGCGTCGACTAGTAC5RACE PCR
IFNLR1-3GSP1CTATTTGGATGTGGAACTGGCTC3RACE PCR
IFNLR1-3GSP2CCTGGATGTATGACTTGAACC3RACE PCR
3RACE-APGGCCACGCGTCGACTAGTACT(17)3RACE PCR
3RACE-AUAPGGCCACGCGTCGACTAGTAC3RACE PCR
IFNLR1-2FATGCTCCTCCATAAGTCGFull-length amplification
IFNLR1-2RGCTGTGACTTCTCCCTGAFull-length amplification
IFNLR1-3FTCTGAAGACAAGAAGCAATqRT-PCR
IFNLR1-3RGCACACTGGTTGGGAGAATqRT-PCR
β-actin-FCCGTGACATCAAGGAGAAqRT-PCR
β-actin-RGAAGGATGGCTGGAAGAGqRT-PCR

We are committed to sharing findings related to COVID-19 as quickly as possible. We will be providing unlimited waivers of publication charges for accepted research articles as well as case reports and case series related to COVID-19. Review articles are excluded from this waiver policy. Sign up here as a reviewer to help fast-track new submissions.