BioMed Research International / 2015 / Article / Tab 1

Research Article

Diffusion and Persistence of Multidrug Resistant Salmonella Typhimurium Strains Phage Type DT120 in Southern Italy

Table 1

Primers used for PCR amplification of resistance genes.

Primer5′-3′ sequenceGene targetAmplicon size (bp)TAReference

aadA1-FTTTGATCAACGACCTTTTGGAAACaadA1 and aadA2 29458°C [9]
aadA-RGGACAACGTAAGCACTACATTTCG

blaoxa30-FATTATCTACAGCAGCGCCAGTGCATCbla OXA-3071663°CThis study
blaoxa30-RTTCGACCCCAAGTTTCCTGTAAGTGC

blaPSE-1-FGGATTACAATGGCAATCAGCGCTTCCbla PSE-165865°C [10]
blaPSE-1-RAATCGCATCATTTCGCTCTGCCATTG

blaTEM1-FTGAAGATCAGTTGGGTGCACGAGTGGbla TEM-170063°C [9]
blaTEM1-RAGTTGCCTGACTCCCCGTCGTGTAGA

catA1-FCACCGTTGATATATCCCAATGGCATCGTcatA1 58262°CThis study
catA1-RCTGCCGACATGGAAGCCATCACAAAC

dfrA1-FTATTCCATGGAGTGCCAAAGGTGAACdfrA1 37563°CThis study
dfrA1-RGAGGCGAAGTCTTGGGTAAAAACTGG

dfrA12-FCAGTACGCATTTATCTCGTTGCTGCGdfrA12 41763°CThis study
dfrA12-RCAAGCTCGAATTCTGTTTCGTTGAGC

floR-FCTCCTTTCGACATCCTCGCTTCACTGfloR 63664°C [10]
floR-RAGAAGACGAAGAAGGTGCCCATACCG

sul1-FTCGGCATTCTGAATCTCACCGAGGACsul1 78664°C [10]
sul1-RAAATTTCGCGAGGGTTTCCGAGAAGG

sul2-FGACAGTTTCTCCGATGGAGGCCGGTAsul2 70064°C [10]
sul2-RGTGTGCGGATGAAGTCAGCTCCACCT

strA-FTGGTTGCCTGTCAGAGGCGGAGAATCstrAB 146663°C [9]
strB-RATCGACGTCCAGCGCACGAGAGAATG

tetA-FCCTGATCGTAATTCTGAGCACTGTCGtet(A)108963°CThis study
tetA-RCACCCGTTCCACGTTGTTATAGAAGC

tetB-FCAGGTTATCTTTGCTCCTTGGCTTGGtet(B)101463°C [9]
tetB-RTTGAGGGGTTAACATGAAGGTCATCG

tetC-FGGATATCGTCCATTCCGACAGCATCGtet(C)74563°C [9]
tetC-RGATAATGGCCTGCTTCTCGCCGAAAC

tetD-FACTGTCCAATGTGCTGTGGATGTTGTtet(D) 74763°CThis study
tetD-RCTGACCAGCACACCCTGTAGTTTTCC

tetG-FGAGCCGCAGTCGATTACACGATTATGtet(G)68064°C [10]
tetG-RCAACAGAATCGGGAACACCATCCATC

intI1-FCGAACCGAACAGGCTTATGTCCACTGintI1 83863°C [10]
intI1-RCATCGTCGTAGAGACGTCGGAATGG

5CS-FGCCTCGGGCATCCAAGCAGCAAGC5′CS attI1 end 3′CSvariable65°CThis study
3CS-RCTTGACCTGATAGTTTGGCTGTGAGCAA

U7-L12ACACCTTGAGCAGGGCAAAGtdhF 50060°C [4]
LJ-R1AGTTCTAAAGGTTCGTAGTCGint

104-RJTGACGAGCTGAAGCGAATTGS04451560°C [4]
C9-LAGCAAGTGTGCGTAATTTGGint2

We are committed to sharing findings related to COVID-19 as quickly as possible. We will be providing unlimited waivers of publication charges for accepted research articles as well as case reports and case series related to COVID-19. Review articles are excluded from this waiver policy. Sign up here as a reviewer to help fast-track new submissions.