BioMed Research International / 2015 / Article / Tab 1

Research Article

Diffusion and Persistence of Multidrug Resistant Salmonella Typhimurium Strains Phage Type DT120 in Southern Italy

Table 1

Primers used for PCR amplification of resistance genes.

Primer5′-3′ sequenceGene targetAmplicon size (bp)TAReference

aadA1-FTTTGATCAACGACCTTTTGGAAACaadA1 and aadA2 29458°C [9]

















5CS-FGCCTCGGGCATCCAAGCAGCAAGC5′CS attI1 end 3′CSvariable65°CThis study



Article of the Year Award: Outstanding research contributions of 2020, as selected by our Chief Editors. Read the winning articles.