Table 1: Primer sequences for quantitative real-time PCR.

Gene namePrimerProduct (bp)Accession number

BDNFForward: AGCTGAGCGTGTGTGACAGTATTAG
Reverse: ATTGCTTCAGTTGGCCTTTTGATAC
129NM_170735

CREBForward: ACCTGCCATCACCACTGTAACG
Reverse: GGGTGCTGTGCGAATCTGGGTA
289NM_004379

ERK1Forward: GCAGTTCTGGAATGGAAGGGTT
Reverse: GGGGTTTGAATGAGATGAGGG
120NM_001109891

ERK2Forward: ATTACGACCCGAGTGACGAG
Reverse: ACTGGGAAGAAGAACACCGA
200NM_002745

-ActinForward: TGAAGGTGACAGCAGTCGGTT
Reverse: ACTTCCTGTAACAACGCATCTCATA
126NM_001101