BioMed Research International / 2015 / Article / Tab 1

Research Article

Characterization of Multidrug Resistant Extended-Spectrum Beta-Lactamase-Producing Escherichia coli among Uropathogens of Pediatrics in North of Iran

Table 1

The sequences of primers and thermal condition used in PCR amplification.

Target genesPrimer used (5′-3′)Thermal cycling conditionPCR product size

TEM TAATCAGTGAGGCACCTATCTC
GAGTATTCAACATTTCCGTGTC [18, 19]
94°C 3 min → 35   94°C 30 sec, 45°C
45 sec, 72°C 40 sec → 72°C 7 min
800 bp

CTX TTTGCGATGTGCAGTACCAGTAA
CGATATCGTTGGTGGCATA [20]
94°C 5 min → 40   94°C 45 sec,
53.1°C 45 sec, 72°C 1 min → 72°C 7 min
593 bp

VEB CGACTTCCATTTCCCGATGC GGACTCTGCAACAAATACGC [9]93°C 3 min → 40   93°C 1 min,
54.9°C 1 min, 72°C 1 min → 72°C 7 min
585 bp

SHV GGTTATGCGTTATATTCGCC
TTAGCGTTGCCAGTGCTC [21]
1 cycle of 5 min at 96°C; 35 cycles of
1 min at 96°C, 1 min at 60°C, 1 min at
72°C; 1 cycle of 10 min at 72°C
867 bp

GES ATGCGCTTCATTCACGCAC CTATTTGTCCGTGCTCAGG [22]1 cycle of 5 min at 95°C; 30 cycles of 1 min
at 95°C, 45 sec at 55°C, 1 min 30 sec
at 72°C; 1 cycle of 8 min at 72°C
846 bp

We are committed to sharing findings related to COVID-19 as quickly and safely as possible. Any author submitting a COVID-19 paper should notify us at help@hindawi.com to ensure their research is fast-tracked and made available on a preprint server as soon as possible. We will be providing unlimited waivers of publication charges for accepted articles related to COVID-19.