Research Article
Sliding Motility, Biofilm Formation, and Glycopeptidolipid Production in Mycobacterium colombiense Strains
Table 1
Bacterial strains and primers used in this study.
| Strain and primers | Description | Source |
| M. colombiense (CECT 3035) | Sequence genome strain | Clinical isolate | M. colombiense 19B and 57B | Clinical isolates | Clinical isolate | M. smegmatis mc2155 | Reference strain | [28] | M. avium 104 | Reference strain | [27] | P. aeruginosa ATCC27853 | Reference strain | [29] |
| Primers | Sequence (5′-3′) | |
| pstA dir | ACAGGGCACGAGGAATTCTA | This study | pstA rev | TAGTCCTCGGAGGCTTCGTA | This study | gftA dir | ATGTGTGCTGGCCAGTTATG | This study | gftA rev | GGAAGAACGACGTCCAGAAG | This study | rtfA dir | GACTTTTGGAGCGACGAGTT | This study | rtfA rev | GCCAAATCCTGGTAAAGCTG | This study | mtfB dir | GGACACCGAGCACTACGAG | This study | mtfB rev | TCATACAGATCGCCATCCAG | This study | mtfC dir | ACAAGGCGGATAAAGGGATT | This study | mtfC rev | CTCATACAGATCGCCATCCA | This study | mtfD dir | TACCTGCTCGACACCTTCG | This study | mtfD rev | TCGACCTGCTCGAGTGTCT | This study | tmtpC dir | TTCATTCGGGATACCAGGAG | This study | tmtpC rev | TTGATCCTGACCCGAAGTTT | This study | tmtpA dir | CTCTCGGCTTTGACGACAC | This study | tmtpA rev | ATGGCCGACATCAGCTACTT | This study | tmtpB dir | GAGTGCCCTTGAGTGATTCC | This study | tmtpB rev | CCTCCAAGAATGACGATTCC | This study | 16 sRNA dir | GAGATAGGCGTTCCCTTGTG | This study | 16 sRNA rev | CTGGACATAAGGGGCATGAT | This study |
|
|