The Type III Secretion System (T3SS) of <i>Chlamydophila psittaci</i> Is Involved in the Host Inflammatory Response by Activating the JNK/ERK Signaling Pathway

<div class="floats-full-page floats-full-page-other"><h2>Table 1</h2><div class="floats-full-page-caption">Primers used in the Q-PCR analysis.</div><div class="floats-full-page-content"><table class="table-group" id="tab1"><tr><td><table class="table"><tr><td class="thead-hr" colspan="5"><hr /></td></tr><tr class="thead"><td align="left">Gene name</td><td align="center">Forward primer</td><td align="center">Reverse primer</td><td align="center">Product (bp)</td><td align="center">Accession number</td></tr><tr><td class="thead-hr" colspan="5"><hr /></td></tr><tr><td align="left"><svg height="13.2498pt" id="M4" style="vertical-align:-3.571899pt" version="1.1" viewbox="-0.0498162 -9.6779 8.00062 13.2498" width="8.00062pt" xmlns="http://www.w3.org/2000/svg" xmlns:xlink="http://www.w3.org/1999/xlink"><g transform="matrix(.0135,0,0,-0.0135,0,0)"><path d="M558 587C558 666 497 712 432 712C379 712 330 691 284 650C212 586 178 508 148 348L71 -65C49 -185 35 -229 23 -235L27 -261C49 -259 101 -251 124 -224C131 -216 138 -178 159 -24C171 66 197 200 227 356C264 550 295 668 393 668C443 668 479 632 479 575C479 516 446 458 383 418C361 404 344 398 318 397L296 350C395 338 460 281 460 192C460 110 411 40 300 40C258 40 215 55 192 69L181 51C191 18 222 -16 266 -16C308 -16 351 1 397 26C471 67 545 142 545 221C545 315 486 365 401 395C469 437 558 498 558 587Z" id="g113-224"></path><glyph.data ascent="3473" descent="-2876" horiz-adv-x="581" vert-adv-y="581"></glyph.data></g></svg>-Actin</td><td align="center">GACTTAGTTGCGTTACACCCTTTC</td><td align="center">CTGCTGTCACCTTCACCGTTC</td><td align="center">161</td><td align="center">NM_001101.3</td></tr><tr><td align="left">IL-1<svg height="13.2498pt" id="M5" style="vertical-align:-3.571899pt" version="1.1" viewbox="-0.0498162 -9.6779 8.00062 13.2498" width="8.00062pt" xmlns="http://www.w3.org/2000/svg" xmlns:xlink="http://www.w3.org/1999/xlink"><g transform="matrix(.0135,0,0,-0.0135,0,0)"><path d="M558 587C558 666 497 712 432 712C379 712 330 691 284 650C212 586 178 508 148 348L71 -65C49 -185 35 -229 23 -235L27 -261C49 -259 101 -251 124 -224C131 -216 138 -178 159 -24C171 66 197 200 227 356C264 550 295 668 393 668C443 668 479 632 479 575C479 516 446 458 383 418C361 404 344 398 318 397L296 350C395 338 460 281 460 192C460 110 411 40 300 40C258 40 215 55 192 69L181 51C191 18 222 -16 266 -16C308 -16 351 1 397 26C471 67 545 142 545 221C545 315 486 365 401 395C469 437 558 498 558 587Z" id="g113-224"></path><glyph.data ascent="3473" descent="-2876" horiz-adv-x="581" vert-adv-y="581"></glyph.data></g></svg></td><td align="center">CTACGAATCTCCGACCACCA</td><td align="center">GGCAGGGAACCAGCATCTT</td><td align="center">97</td><td align="center">NM_000576</td></tr><tr><td align="left">IL-6</td><td align="center">AATAACCACCCCTGACCCAA</td><td align="center">TTTGCCGAAGAGCCCTCA</td><td align="center">147</td><td align="center">NM_000600</td></tr><tr><td align="left">IL-8</td><td align="center">AGACATACTCCAAACCTTTCCACC</td><td align="center">ACAACCCTCTGCACCCAGTT</td><td align="center">156</td><td align="center">NM_000584</td></tr><tr><td align="left">TNF-<svg height="6.42315pt" id="M6" style="vertical-align:-0.2129903pt" version="1.1" viewbox="-0.0498162 -6.21016 7.82384 6.42315" width="7.82384pt" xmlns="http://www.w3.org/2000/svg" xmlns:xlink="http://www.w3.org/1999/xlink"><g transform="matrix(.0135,0,0,-0.0135,0,0)"><path d="M545 106L524 126C493 85 467 65 455 65C438 65 427 113 405 238C448 295 498 362 543 439L533 448L478 435C453 386 423 331 398 295H395C370 404 347 448 282 448C169 448 23 309 23 153C23 54 65 -12 128 -12C203 -12 283 70 339 155H341C360 29 380 -12 411 -12C444 -12 491 11 545 106ZM333 204C265 95 210 54 169 54C137 54 113 96 113 171C113 302 191 405 252 405C301 405 318 306 333 204Z" id="g113-223"></path><glyph.data ascent="3473" descent="-2876" horiz-adv-x="568" vert-adv-y="568"></glyph.data></g></svg></td><td align="center">AGCTGGAGAAGGGTGACCGA</td><td align="center">CAGGGCAATGATCCCAAAGTA</td><td align="center">99</td><td align="center">NM_000594</td></tr><tr class="table-tr"><td colspan="5"><hr class="tbody-hr" /></td></tr></table></td></tr></table></div></div>

Table 1 | The Type III Secretion System (T3SS) of <i>Chlamydophila psittaci</i> Is Involved in the Host Inflammatory Response by Activating the JNK/ERK Signaling Pathway

title

Table 1: The Type III Secretion System (T3SS) of <i>Chlamydophila psittaci</i> Is Involved in the Host Inflammatory Response by Activating the JNK/ERK Signaling Pathway

description

Table 1 | The Type III Secretion System (T3SS) of Chlamydophila psittaci Is Involved in the Host Inflammatory Response by Activating the JNK/ERK Signaling Pathway

Table 1

About this journal

<p><em>BioMed Research International</em> publishes original research articles, review articles, and clinical studies covering a wide range of subjects within the biomedical sciences. The journal will accept both basic and translational research.</p>


Journal profile

Meet the editorial board

<p><em>BioMed Research International</em> maintains an Editorial Board of practicing researchers from around the world, to ensure manuscripts are handled by editors who are experts in the field of study.</p>


Editor spotlight

Submit to Special Issue

We currently have a number of Special Issues open for submission. Special Issues highlight emerging areas of research within a field, or provide a venue for a deeper investigation into an existing research area.