BioMed Research International / 2015 / Article / Tab 1

Research Article

The Type III Secretion System (T3SS) of Chlamydophila psittaci Is Involved in the Host Inflammatory Response by Activating the JNK/ERK Signaling Pathway

Table 1

Primers used in the Q-PCR analysis.

Gene nameForward primerReverse primerProduct (bp)Accession number

-ActinGACTTAGTTGCGTTACACCCTTTCCTGCTGTCACCTTCACCGTTC161NM_001101.3
IL-1CTACGAATCTCCGACCACCAGGCAGGGAACCAGCATCTT97NM_000576
IL-6AATAACCACCCCTGACCCAATTTGCCGAAGAGCCCTCA147NM_000600
IL-8AGACATACTCCAAACCTTTCCACCACAACCCTCTGCACCCAGTT156NM_000584
TNF-AGCTGGAGAAGGGTGACCGACAGGGCAATGATCCCAAAGTA99NM_000594