BioMed Research International / 2015 / Article / Tab 1

Research Article

Generation and Characterization of a Transgenic Mouse Carrying a Functional Human β-Globin Gene with the IVSI-6 Thalassemia Mutation

Table 1

PCR primers employed for identification and characterization of transgenic mice.

NameSequenceLength (nt)Melting temperature (°C)Gene

MuActF 5′ TGACGGGGTCAACCACACTGTGCCCATCTA 3′3081Murine β-actin
MuActR 5′ CTAGAAGCATTTGCGGTGGACGATGGAGGG 3′3080Murine β-actin
TransF 5′ TGCATTCATTTGTTGTTGTTTTTCT 3′2565Transgene (LCR)
TransF [6FAM]5′ [6-FAM] TGCATTCATTTGTTGTTGTTTTTCT 3′2565Transgene (LCR)
TransR 5′ TGACTAAAACTCCACCTCAAACGG 3′2467Transgene (LCR)
HuBetaF 5′ AGACCTCACCCTGTGGAGCC 3′2068Human β-globin
HuBetaR 5′ TCAGGAGTGGACAGATCCCC 3′2067Human β-globin
MuActF1 [6FAM]5′ [6-FAM] TACTTTGGGAGTGGCAAGCC 3′2066Murine β-actin
MuActR1 5′ TCTCCATGTCGTCCCAGTTG 3′2066Murine β-actin

We are committed to sharing findings related to COVID-19 as quickly and safely as possible. Any author submitting a COVID-19 paper should notify us at help@hindawi.com to ensure their research is fast-tracked and made available on a preprint server as soon as possible. We will be providing unlimited waivers of publication charges for accepted articles related to COVID-19.