Cyclic Tensile Strain Induces Tenogenic Differentiation of Tendon-Derived Stem Cells in Bioreactor Culture

Table 1

Real-time PCR primers used in this study. Primers for type I collagen, tenascin-C, tenomodulin, and scleraxis and GAPDH were designed and synthesized by Sangon Biotech Co., Ltd.

Gene	Sequence
Type I collagen	Forward	5′ tcagaacatcacctaccactgc 3′
	Reverse	5′ attgtctttccccattcatttg 3′
Tenascin-C	Forward	5′ atcaccaccaagttcacaacag 3′
	Reverse	5′ ccatccacagattcatagagca 3′
Tenomodulin	Forward	5′ tccacaattcggcataatc 3′
	Reverse	5′ caggtccgggattctgtgt 3′
Scleraxis	Forward	5′ ccacaccaagcattttcaga 3′
	Reverse	5′acacaaaggacggcatcac 3′
GAPDH	Forward	5′ atggtgaaggtcggagtgaa 3′
	Reverse	5′ tgggtggaatcatactggaac 3′