BioMed Research International / 2015 / Article / Tab 1

Research Article

A Novel Reference Plasmid for the Qualitative Detection of Genetically Modified Rice in Food and Feed

Table 1

Primer information for pBJGMM001.

TargetPrimersSequences (5′-3′)Amplicon (bp)Source

SPSSPS-FATCTGTTTACTCGTCAAGTGTCATCTC287 MOA 1861-1-2012 [26]
SPS-RGCCATGGATTACATATGGCAAGA

PEPCPEPC-FTCCCTCCAGAAGGTCTTTGTGTC271 MOA 1861-1-2012 [26]
PEPC-RGCTGGCAACTGGTTGGTAATG

T-NOSNOS-FGAATCCTGTTGCCGGTCTTG180 MOA 953-6-2007 [27]
NOS-RGAATCCTGTTGCCGGTCTTG

CaMV35S35S-FGCTCCTACAAATGCCATCATTGC195 MOA 953-6-2007 [27]
35S-RGATAGTGGGATTGTGCGTCATCCC

UbiUbi-FCCGTAATAAATAGACACCC314 SN/T 1943-2007 [28]
Ubi-RAACACTGGCAAGTTAGCAAT

BarBar-FGCTGCCAGAAACCCACGTCAT430 SN/T 1197-2003 [29]
Bar-RACCATCGTCAACCACTACACCG

HptHpt-FTCGCCTCGCTCCAGTCAATG472 MOA 1782-2-2012 [30]
Hpt-RGTTCACAGGGTGTCACGTTGC

Article of the Year Award: Outstanding research contributions of 2020, as selected by our Chief Editors. Read the winning articles.