Research Article

Rapid and Quantitative Detection of Leifsonia xyli subsp. xyli in Sugarcane Stalk Juice Using a Real-Time Fluorescent (TaqMan) PCR Assay

Table 1

Primers and probe information for Leifsonia xyli subsp. xyli (Lxx).

Primer/probeSenseSequence (5′-3′)Gene targetAmplicon size (bp)Reference

Pat1-F1ForwardTTGTTTAGTTTTCGTTGGCGPat1942In this study
Pat1-R1ReverseCTATGCTGGAGCCACAG
CxxITSf#5ForwardTCAACGCAGAGATTGTCCAITS305Fegan et al., 1998 [19]
CxxITSr#5ReverseGTACGGGCGGTACCTTTTC
Pat1-F2ForwardGGAATACTCGCTATGTGTTGPat1597In this study
Pat1-R2ReverseCCAATACTATGCCGTAGAAAG
Pat1-QFForwardGGTTCCATTGCTTACCGATTPat1106Wang et al., 2015 [23]
Pat1-QRReverseCAAGTTTCGACAGGAACAGC
Pat1-QPProbeFAM-CCACGGCTACGTCAATTCGGG-TAMRA

FAM, 6-carboxy-fluorescein reporter dye; TAMRA, 6-carboxytetramethylrhodamine fluorescent quencher.
Primers and probe targeted at Pat1 gene of Leifsonia xyli subsp. xyli (strain CTCB07, GenBank acc. number NC_006087) were designed by authors of this study and Wang et al. [23]. CxxITSf#5/CxxITSr#5 targeted at 16S-23S rRNA internal transcribed spacer (ITS) regions reported by Fegan et al. [19].