BioMed Research International / 2016 / Article / Tab 1

Research Article

Development of a Rapid Point-of-Use DNA Test for the Screening of Genuity® Roundup Ready 2 Yield® Soybean in Seed Samples

Table 1

Sequences of RPA and PCR primers and probes used in the study.

AssayDescription Sequence

RPARR2Y probecccgccttcagtttaaactatcagtgtttggagc-T(BHQ-2)-t-dSpacer-a-T(TAMRA)-aaccacgattgaag
RR2Y forward primerccctcttggcttttctaagtttgagctcgttactg
RR2Y reverse primercccgccttcagtttaaactatcagtgtttgg
lec probeggaaactgtttctttcagctggaacaag-T(FAM)-t-dSpacer-g-T(BHQ-1)-gccgaagcaacc
lec forward primerccagaatgtggttgtatctctctccctaacctt
lec reverse primercccgaggaggtcacaatagcgtctccttggag

PCRRR1 forward primertttgggaccactgtcggcagaggcatctt
RR1 reverse primergatttgaattcagaaccttgtgca
RR2Y forward primertcccgctctagcgcttcaat
RR2Y reverse primertcgagcaggacctgcagaa
lec forward primergtttgacactttccggaactcttg
lec reverse primer ctgtcacatttagatggcctcatg

BHQ = dT Black Hole Quencher; TAMRA = dT TAMRA; FAM = dT FAM.

We are committed to sharing findings related to COVID-19 as quickly as possible. We will be providing unlimited waivers of publication charges for accepted research articles as well as case reports and case series related to COVID-19. Review articles are excluded from this waiver policy. Sign up here as a reviewer to help fast-track new submissions.