Table of Contents Author Guidelines Submit a Manuscript
Retracted

BioMed Research International has retracted this article. A series of very similar articles on shRNA and cancer cell lines was identified by Byrne and Labbé [2], and the intertextual distance between this article and an article in the series [3] is lower than expected by chance. The following concerns were found:(i)The supposed nontargeting control shRNA sequence, 5 GCGGAGGGTTTGAAAGAATATCTCGAGATATTCTTTCAAACCCTCCGCTTTTTT-3, targets TPD52L2 (NM_199360). The same sequence was used as a nontargeting control in other articles identified by Byrne and Labbé.(ii)The article is very similar in methods and structure to two other studies that also use this incorrect sequence [4, 5].The authors did not respond to requests for comment.

View the full Retraction here.

References

  1. X. Huang, W. Zhou, Y. Zhang, and Y. Liu, “High expression of ptgr1 promotes NSCLC cell growth via positive regulation of cyclin-dependent protein kinase complex,” BioMed Research International, vol. 2016, Article ID 5230642, 2016.
  2. J. A. Byrne and C. Labbé, “Striking similarities between publications from China describing single gene knockdown experiments in human cancer cell lines,” Scientometrics, vol. 110, no. 3, pp. 1471–1493, 2017.
  3. Y. Wang, T. Jin, X. Dai, and J. Xu, “Lentivirus-mediated knockdown of CEP55 suppresses cell proliferation of breast cancer cells,” BioScience Trends, vol. 10, no. 1, pp. 67–73, 2016.
  4. X. Zhao, M. Chen, and J. Tan, “Knockdown of ZFR suppresses cell proliferation and invasion of human pancreatic cancer,” Biological Research, vol. 49, no. 1, 2016.
  5. C. Zhang, J. Fu, F. Xue et al., “Knockdown of ribosomal protein S15A induces human glioblastoma cell apoptosis,” World Journal of Surgical Oncology, vol. 14, no. 1, article no. 129, 2016.
BioMed Research International
Volume 2016, Article ID 5230642, 12 pages
http://dx.doi.org/10.1155/2016/5230642
Research Article

High Expression of PTGR1 Promotes NSCLC Cell Growth via Positive Regulation of Cyclin-Dependent Protein Kinase Complex

Department of Cardiothoracic Surgery, The Second Affiliated Hospital of Wenzhou Medical University, Wenzhou, Zhejiang 325027, China

Received 7 January 2016; Revised 26 April 2016; Accepted 29 May 2016

Academic Editor: Jerome Moreaux

Copyright © 2016 Xianping Huang et al. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

Abstract

Lung cancer has been the most common cancer and the main cause of cancer-related deaths worldwide for several decades. PTGR1 (prostaglandin reductase 1), as a bifunctional enzyme, has been involved in the occurrence and progression of cancer. However, its impact on human lung cancer is rarely reported. In this study, we found that PTGR1 was overexpressed in lung cancer based on the analyses of Oncomine. Moreover, lentivirus-mediated shRNA knockdown of PTGR1 reduced cell viability in human lung carcinoma cells 95D and A549 by MTT and colony formation assay. PTGR1 depletion led to G2/M phase cell cycle arrest and increased the proportion of apoptotic cells in 95D cells by flow cytometry. Furthermore, silencing PTGR1 in 95D cells resulted in decreased levels of cyclin-dependent protein kinase complex (CDK1, CDK2, cyclin A2, and cyclin B1) by western blotting and then PTGR1 is positively correlated with cyclin-dependent protein by using the data mining of the Oncomine database. Therefore, our findings suggest that PTGR1 may play a role in lung carcinogenesis through regulating cell proliferation and is a potential new therapeutic strategy for lung cancer.