Table of Contents Author Guidelines Submit a Manuscript
Retracted

BioMed Research International has retracted this article. A series of very similar articles on shRNA and cancer cell lines was identified by Byrne and Labbé [2], and the intertextual distance between this article and an article in the series [3] is lower than expected by chance. The following concerns were found:(i)The supposed nontargeting control shRNA sequence, 5 GCGGAGGGTTTGAAAGAATATCTCGAGATATTCTTTCAAACCCTCCGCTTTTTT-3, targets TPD52L2 (NM_199360). The same sequence was used as a nontargeting control in other articles identified by Byrne and Labbé.(ii)The article is very similar in methods and structure to two other studies that also use this incorrect sequence [4, 5].The authors did not respond to requests for comment.

View the full Retraction here.

References

  1. X. Huang, W. Zhou, Y. Zhang, and Y. Liu, “High expression of ptgr1 promotes NSCLC cell growth via positive regulation of cyclin-dependent protein kinase complex,” BioMed Research International, vol. 2016, Article ID 5230642, 2016.
  2. J. A. Byrne and C. Labbé, “Striking similarities between publications from China describing single gene knockdown experiments in human cancer cell lines,” Scientometrics, vol. 110, no. 3, pp. 1471–1493, 2017.
  3. Y. Wang, T. Jin, X. Dai, and J. Xu, “Lentivirus-mediated knockdown of CEP55 suppresses cell proliferation of breast cancer cells,” BioScience Trends, vol. 10, no. 1, pp. 67–73, 2016.
  4. X. Zhao, M. Chen, and J. Tan, “Knockdown of ZFR suppresses cell proliferation and invasion of human pancreatic cancer,” Biological Research, vol. 49, no. 1, 2016.
  5. C. Zhang, J. Fu, F. Xue et al., “Knockdown of ribosomal protein S15A induces human glioblastoma cell apoptosis,” World Journal of Surgical Oncology, vol. 14, no. 1, article no. 129, 2016.
BioMed Research International
Volume 2016, Article ID 5230642, 12 pages
http://dx.doi.org/10.1155/2016/5230642
Research Article

High Expression of PTGR1 Promotes NSCLC Cell Growth via Positive Regulation of Cyclin-Dependent Protein Kinase Complex

Department of Cardiothoracic Surgery, The Second Affiliated Hospital of Wenzhou Medical University, Wenzhou, Zhejiang 325027, China

Received 7 January 2016; Revised 26 April 2016; Accepted 29 May 2016

Academic Editor: Jerome Moreaux

Copyright © 2016 Xianping Huang et al. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

Citations to this Article [5 citations]

The following is the list of published articles that have cited the current article.

  • Lindsay S. Roberts, Peter Yan, Leslie A. Bateman, and Daniel K. Nomura, “Mapping Novel Metabolic Nodes Targeted by Anti-Cancer Drugs that Impair Triple-Negative Breast Cancer Pathogenicity,” ACS Chemical Biology, vol. 12, no. 4, pp. 1133–1140, 2017. View at Publisher · View at Google Scholar
  • Qin Qin Cui, Yihe Wu, Hongyan Wang, Xiu Jun Wang, Akhileshwar Namani, and Xiuwen Tang, “NRF2-regulated metabolic gene signature as a prognostic biomarker in non-small cell lung cancer,” Oncotarget, vol. 8, no. 41, pp. 69847–69862, 2017. View at Publisher · View at Google Scholar
  • Xiaoqi Zhang, Hao Feng, Ziyu Li, Jie Guo, and Minqi Li, “Aspirin is Involved in the Cell Cycle Arrest, Apoptosis, Cell Migration, and Invasion of Oral Squamous Cell Carcinoma,” International Journal of Molecular Sciences, vol. 19, no. 7, pp. 2029, 2018. View at Publisher · View at Google Scholar
  • Oshrat Hershkovitz-Rokah, Mali Salmon-Divon, Polina Geva, Ofer Shpilberg, and Stella Liberman-Aronov, “Network analysis of microRNAs, genes and their regulation in diffuse and follicular B-cell lymphomas,” Oncotarget, vol. 9, no. 8, pp. 7928–7941, 2018. View at Publisher · View at Google Scholar
  • Guoying Wang, Wei Liu, Yong Zou, Genshu Wang, Yinan Deng, Jingyan Luo, Yingcai Zhang, Hua Li, Qi Zhang, Yang Yang, and Guihua Chen, “Three isoforms of exosomal circPTGR1 promote hepatocellular carcinoma metastasis via the miR449a–MET pathway,” EBioMedicine, 2019. View at Publisher · View at Google Scholar