Table of Contents Author Guidelines Submit a Manuscript
Retracted

BioMed Research International has retracted this article. A series of very similar articles on shRNA and cancer cell lines was identified by Byrne and Labbé [2], and the intertextual distance between this article and an article in the series [3] is lower than expected by chance. The following concerns were found:(i)The supposed nontargeting control shRNA sequence, 5 GCGGAGGGTTTGAAAGAATATCTCGAGATATTCTTTCAAACCCTCCGCTTTTTT-3, targets TPD52L2 (NM_199360). The same sequence was used as a nontargeting control in other articles identified by Byrne and Labbé.(ii)The article is very similar in methods and structure to two other studies that also use this incorrect sequence [4, 5].The authors did not respond to requests for comment.

View the full Retraction here.

References

  1. X. Huang, W. Zhou, Y. Zhang, and Y. Liu, “High expression of ptgr1 promotes NSCLC cell growth via positive regulation of cyclin-dependent protein kinase complex,” BioMed Research International, vol. 2016, Article ID 5230642, 2016.
  2. J. A. Byrne and C. Labbé, “Striking similarities between publications from China describing single gene knockdown experiments in human cancer cell lines,” Scientometrics, vol. 110, no. 3, pp. 1471–1493, 2017.
  3. Y. Wang, T. Jin, X. Dai, and J. Xu, “Lentivirus-mediated knockdown of CEP55 suppresses cell proliferation of breast cancer cells,” BioScience Trends, vol. 10, no. 1, pp. 67–73, 2016.
  4. X. Zhao, M. Chen, and J. Tan, “Knockdown of ZFR suppresses cell proliferation and invasion of human pancreatic cancer,” Biological Research, vol. 49, no. 1, 2016.
  5. C. Zhang, J. Fu, F. Xue et al., “Knockdown of ribosomal protein S15A induces human glioblastoma cell apoptosis,” World Journal of Surgical Oncology, vol. 14, no. 1, article no. 129, 2016.
BioMed Research International
Volume 2016, Article ID 5230642, 12 pages
http://dx.doi.org/10.1155/2016/5230642
Research Article

High Expression of PTGR1 Promotes NSCLC Cell Growth via Positive Regulation of Cyclin-Dependent Protein Kinase Complex

Department of Cardiothoracic Surgery, The Second Affiliated Hospital of Wenzhou Medical University, Wenzhou, Zhejiang 325027, China

Received 7 January 2016; Revised 26 April 2016; Accepted 29 May 2016

Academic Editor: Jerome Moreaux

Copyright © 2016 Xianping Huang et al. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

Linked References

  1. R. Siegel, J. Ma, Z. Zou, and A. Jemal, “Cancer statistics, 2014,” CA— A Cancer Journal for Clinicians, vol. 64, no. 1, pp. 9–29, 2014. View at Publisher · View at Google Scholar · View at Scopus
  2. J. Ferlay, I. Soerjomataram, R. Dikshit et al., “Cancer incidence and mortality worldwide: sources, methods and major patterns in GLOBOCAN 2012,” International Journal of Cancer, vol. 136, no. 5, pp. E359–E386, 2015. View at Publisher · View at Google Scholar · View at Scopus
  3. M. Karam-Hage, P. M. Cinciripini, and E. R. Gritz, “Tobacco use and cessation for cancer survivors: an overview for clinicians,” Cancer Journal for Clinicians, vol. 64, no. 4, pp. 272–290, 2014. View at Publisher · View at Google Scholar · View at Scopus
  4. F. A. Shepherd, J. Y. Douillard, and G. R. Blumenschein Jr., “Immunotherapy for non-small cell lung cancer: novel approaches to improve patient outcome,” Journal of Thoracic Oncology, vol. 6, no. 10, pp. 1763–1773, 2011. View at Publisher · View at Google Scholar · View at Scopus
  5. T. Yokomizo, Y. Ogawa, N. Uozumi, K. Kume, T. Izumi, and T. Shimizu, “cDNA cloning, expression, and mutagenesis study of leukotriene B4 12-hydroxydehydrogenase,” The Journal of Biological Chemistry, vol. 271, no. 5, pp. 2844–2850, 1996. View at Publisher · View at Google Scholar · View at Scopus
  6. C. B. Clish, B. D. Levy, N. Chiang, H.-H. Tai, and C. N. Serhan, “Oxidoreductases in lipoxin A4 metabolic inactivation: a novel role for 15-oxoprostaglandin 13-reductase/leukotriene B4 12-hydroxydehydrogenase in inflammation,” The Journal of Biological Chemistry, vol. 275, no. 33, pp. 25372–25380, 2000. View at Publisher · View at Google Scholar · View at Scopus
  7. H.-H. Tai, C. M. Ensor, M. Tong, H. Zhou, and F. Yan, “Prostaglandin catabolizing enzymes,” Prostaglandins & Other Lipid Mediators, vol. 68-69, pp. 483–493, 2002. View at Publisher · View at Google Scholar · View at Scopus
  8. D. M. Tobin, F. J. Roca, J. P. Ray, D. C. Ko, and L. Ramakrishnan, “An enzyme that inactivates the inflammatory mediator leukotriene B4 restricts mycobacterial infection,” PLoS ONE, vol. 8, no. 7, Article ID e67828, 2013. View at Publisher · View at Google Scholar · View at Scopus
  9. R. Sánchez-Rodríguez, J. E. Torres-Mena, M. De-La-Luz-Cruz et al., “Increased expression of prostaglandin reductase 1 in hepatocellular carcinomas from clinical cases and experimental tumors in rats,” The International Journal of Biochemistry & Cell Biology, vol. 53, pp. 186–194, 2014. View at Publisher · View at Google Scholar · View at Scopus
  10. L. Tapak, M. Saidijam, M. Sadeghifar, J. Poorolajal, and H. Mahjub, “Competing risks data analysis with high-dimensional covariates: an application in bladder cancer,” Genomics, Proteomics & Bioinformatics, vol. 13, no. 3, pp. 169–176, 2015. View at Publisher · View at Google Scholar · View at Scopus
  11. N. Jehmlich, P. Stegmaier, C. Golatowski et al., “Differences in the whole saliva baseline proteome profile associated with development of oral mucositis in head and neck cancer patients undergoing radiotherapy,” Journal of Proteomics, vol. 125, pp. 98–103, 2015. View at Publisher · View at Google Scholar · View at Scopus
  12. D. R. Rhodes, J. Yu, K. Shanker et al., “ONCOMINE: a cancer microarray database and integrated data-mining platform,” Neoplasia, vol. 6, no. 1, pp. 1–6, 2004. View at Publisher · View at Google Scholar · View at Scopus
  13. D. G. Beer, S. L. R. Kardia, C.-C. Huang et al., “Gene-expression profiles predict survival of patients with lung adenocarcinoma,” Nature Medicine, vol. 8, no. 8, pp. 816–824, 2002. View at Publisher · View at Google Scholar · View at Scopus
  14. H. Okayama, T. Kohno, Y. Ishii et al., “Identification of genes upregulated in ALK-positive and EGFR/KRAS/ALK-negative lung adenocarcinomas,” Cancer Research, vol. 72, no. 1, pp. 100–111, 2012. View at Publisher · View at Google Scholar · View at Scopus
  15. M. E. Garber, O. G. Troyanskaya, K. Schluens et al., “Diversity of gene expression in adenocarcinoma of the lung,” Proceedings of the National Academy of Sciences of the United States of America, vol. 98, no. 24, pp. 13784–13789, 2001. View at Publisher · View at Google Scholar · View at Scopus
  16. J. Hou, J. Aerts, B. den Hamer et al., “Gene expression-based classification of non-small cell lung carcinomas and survival prediction,” PloS ONE, vol. 5, no. 4, Article ID e10312, 2010. View at Google Scholar
  17. J. Van Den Brandt, D. Wang, S.-H. Kwon, M. Heinkelein, and H. M. Reichardt, “Lentivirally generated eGFP-transgenic rats allow efficient cell tracking in vivo,” Genesis, vol. 39, no. 2, pp. 94–99, 2004. View at Publisher · View at Google Scholar · View at Scopus
  18. Y.-W. Lan, K.-B. Choo, C.-M. Chen et al., “Hypoxia-preconditioned mesenchymal stem cells attenuate bleomycin-induced pulmonary fibrosis,” Stem Cell Research & Therapy, vol. 6, article 97, 2015. View at Publisher · View at Google Scholar · View at Scopus
  19. X. Zhao, L. Shen, Y. Feng et al., “Decreased expression of RPS15A suppresses proliferation of lung cancer cells,” Tumor Biology, vol. 36, no. 9, pp. 6733–6740, 2015. View at Publisher · View at Google Scholar · View at Scopus
  20. H. Song, J. Pan, Y. Liu et al., “Increased ARPP-19 expression is associated with hepatocellular carcinoma,” International Journal of Molecular Sciences, vol. 16, no. 1, pp. 178–192, 2015. View at Publisher · View at Google Scholar · View at Scopus
  21. X. Chen, S. Wang, N. Wu, and C. S. Yang, “Leukotriene A4 hydrolase as a target for cancer prevention and therapy,” Current Cancer Drug Targets, vol. 4, no. 3, pp. 267–283, 2004. View at Publisher · View at Google Scholar · View at Scopus
  22. W.-G. Tong, X.-Z. Ding, M. S. Talamonti, R. H. Bell, and T. E. Adrian, “LTB4 stimulates growth of human pancreatic cancer cells via MAPK and PI-3 kinase pathways,” Biochemical and Biophysical Research Communications, vol. 335, no. 3, pp. 949–956, 2005. View at Publisher · View at Google Scholar · View at Scopus
  23. W.-G. Tong, X.-Z. Ding, M. S. Talamonti, R. H. Bell, and T. E. Adrian, “Leukotriene B4 receptor antagonist LY293111 induces S-phase cell cycle arrest and apoptosis in human pancreatic cancer cells,” Anti-Cancer Drugs, vol. 18, no. 5, pp. 535–541, 2007. View at Publisher · View at Google Scholar · View at Scopus
  24. G. Modat, A. Muller, A. Mary, C. Grégoire, and C. Bonne, “Differential effects of leukotrienes B4 and C4 on bovine aortic endothelial cell proliferation in vitro,” Prostaglandins, vol. 33, no. 4, pp. 531–538, 1987. View at Publisher · View at Google Scholar · View at Scopus
  25. S. R. Satpathy, V. R. Jala, S. R. Bodduluri et al., “Crystalline silica-induced leukotriene B4-dependent inflammation promotes lung tumour growth,” Nature Communications, vol. 6, article 7064, 2015. View at Publisher · View at Google Scholar · View at Scopus
  26. B. Polla, B. De Rochemonteix, A. F. Junod, and J.-M. Dayer, “Effects of LTB4 and Ca++ ionophore A23187 on the release by human alveolar macrophages of factors controlling fibroblast functions,” Biochemical and Biophysical Research Communications, vol. 129, no. 2, pp. 560–567, 1985. View at Publisher · View at Google Scholar · View at Scopus
  27. J. Z. Haeggström and C. D. Funk, “Lipoxygenase and leukotriene pathways: biochemistry, biology, and roles in disease,” Chemical Reviews, vol. 111, no. 10, pp. 5866–5896, 2011. View at Publisher · View at Google Scholar · View at Scopus
  28. L. M. Knab, P. J. Grippo, and D. J. Bentrem, “Involvement of eicosanoids in the pathogenesis of pancreatic cancer: the roles of cyclooxygenase-2 and 5-lipoxygenase,” World Journal of Gastroenterology, vol. 20, no. 31, pp. 10729–10739, 2014. View at Publisher · View at Google Scholar · View at Scopus
  29. D. K. Vanaja, J. C. Cheville, S. J. Iturria, and C. Y. F. Young, “Transcriptional silencing of zinc finger protein 185 identified by expression profiling is associated with prostate cancer progression,” Cancer Research, vol. 63, no. 14, pp. 3877–3882, 2003. View at Google Scholar · View at Scopus
  30. J. E. Korkola, J. Houldsworth, R. S. V. Chadalavada et al., “Down-regulation of stem cell genes, including those in a 200-kb gene cluster at 12p13.31, is associated with in vivo differentiation of human male germ cell tumors,” Cancer Research, vol. 66, no. 2, pp. 820–827, 2006. View at Publisher · View at Google Scholar · View at Scopus
  31. M. Compagno, W. K. Lim, A. Grunn et al., “Mutations of multiple genes cause deregulation of NF-κB in diffuse large B-cell lymphoma,” Nature, vol. 459, no. 7247, pp. 717–721, 2009. View at Publisher · View at Google Scholar · View at Scopus
  32. Y. Zhao, C.-C. Weng, M. Tong, J. Wei, and H.-H. Tai, “Restoration of leukotriene B4-12-hydroxydehydrogenase/15- oxo-prostaglandin 13-reductase (LTBDH/PGR) expression inhibits lung cancer growth in vitro and in vivo,” Lung Cancer, vol. 68, no. 2, pp. 161–169, 2010. View at Publisher · View at Google Scholar · View at Scopus
  33. S. Yang, F. Luo, J. Wang et al., “Effect of prostaglandin reductase 1 (PTGR1) on gastric carcinoma using lentivirus-mediated system,” International Journal of Clinical and Experimental Pathology, vol. 8, no. 11, pp. 14493–14499, 2015. View at Google Scholar
  34. K. E. Pietsch, J. F. Neels, X. Yu, J. Gong, and S. J. Sturla, “Chemical and enzymatic reductive activation of acylfulvene to isomeric cytotoxic reactive intermediates,” Chemical Research in Toxicology, vol. 24, no. 11, pp. 2044–2054, 2011. View at Publisher · View at Google Scholar · View at Scopus
  35. X. Yu, M. M. Erzinger, K. E. Pietsch et al., “Up-regulation of human prostaglandin reductase 1 improves the efficacy of hydroxymethylacylfulvene, an antitumor chemotherapeutic agent,” Journal of Pharmacology and Experimental Therapeutics, vol. 343, no. 2, pp. 426–433, 2012. View at Publisher · View at Google Scholar · View at Scopus
  36. M. M. Erzinger, C. Bovet, A. Uzozie, and S. J. Sturla, “Induction of complementary function reductase enzymes in colon cancer cells by dithiole-3-thione versus sodium selenite,” Journal of Biochemical and Molecular Toxicology, vol. 29, no. 1, pp. 10–20, 2015. View at Publisher · View at Google Scholar · View at Scopus
  37. J. Yang, Y. Dang, Y. Zhu, and C. Zhang, “Diffuse anterior retinoblastoma: current concepts,” OncoTargets and Therapy, vol. 8, pp. 1815–1821, 2015. View at Publisher · View at Google Scholar · View at Scopus
  38. V. Chiarugi, L. Magnelli, and M. Cinelli, “Complex interplay among apoptosis factors: RB, P53, E2F, TGF-β, cell cycle inhibitors and the BCL2 gene family,” Pharmacological Research, vol. 35, no. 4, pp. 257–261, 1997. View at Publisher · View at Google Scholar · View at Scopus
  39. E. C. Connolly, J. Freimuth, and R. J. Akhurst, “Complexities of TGF-β targeted cancer therapy,” International Journal of Biological Sciences, vol. 8, no. 7, pp. 964–978, 2012. View at Publisher · View at Google Scholar · View at Scopus
  40. C.-H. Heldin, M. Vanlandewijck, and A. Moustakas, “Regulation of EMT by TGFβ in cancer,” FEBS Letters, vol. 586, no. 14, pp. 1959–1970, 2012. View at Publisher · View at Google Scholar · View at Scopus
  41. J. B. Crawley, L. Rawlinson, F. V. Lali, T. H. Page, J. Saklatvala, and B. M. J. Foxwell, “T cell proliferation in response to interleukins 2 and 7 requires p38MAP kinase activation,” The Journal of Biological Chemistry, vol. 272, no. 23, pp. 15023–15027, 1997. View at Publisher · View at Google Scholar · View at Scopus
  42. P. Maher, “p38 mitogen-activated protein kinase activation is required for fibroblast growth factor-2-stimulated cell proliferation but not differentiation,” The Journal of Biological Chemistry, vol. 274, no. 25, pp. 17491–17498, 1999. View at Publisher · View at Google Scholar · View at Scopus
  43. O. Casanovas, F. Miró, J. M. Estanyol, E. Itarte, N. Agell, and O. Bachs, “Osmotic stress regulates the stability of cyclin D1 in a p38(SAPK2)-dependent manner,” The Journal of Biological Chemistry, vol. 275, no. 45, pp. 35091–35097, 2000. View at Publisher · View at Google Scholar · View at Scopus
  44. D. V. Bulavin, Y. Higashimoto, I. J. Popoff et al., “Initiation of a G2/M checkpoint after ultraviolet radiation requires p38 kinase,” Nature, vol. 411, no. 6833, pp. 102–107, 2001. View at Publisher · View at Google Scholar · View at Scopus
  45. E. Y. Chang, Y. C. Chang, C. T. Shun et al., “Inhibition of prostaglandin reductase 2, a putative oncogene overexpressed in human pancreatic adenocarcinoma, induces oxidative stress-mediated cell death involving xCT and CTH gene expressions through 15-keto-PGE2,” PLoS ONE, vol. 11, no. 1, Article ID e0147390, 2016. View at Publisher · View at Google Scholar · View at Scopus
  46. E. Yun-Chia Chang, S.-H. Tsai, C.-T. Shun et al., “Prostaglandin reductase 2 modulates ros-mediated cell death and tumor transformation of gastric cancer cells and is associated with higher mortality in gastric cancer patients,” The American Journal of Pathology, vol. 181, no. 4, pp. 1316–1326, 2012. View at Publisher · View at Google Scholar · View at Scopus
  47. J. M. Gudas, M. Payton, S. Thukral et al., “Cyclin E2, a novel G1 cyclin that binds Cdk2 and is aberrantly expressed in human cancers,” Molecular and Cellular Biology, vol. 19, no. 1, pp. 612–622, 1999. View at Publisher · View at Google Scholar · View at Scopus
  48. A. A. Hizli, Y. Chi, J. Swanger et al., “Phosphorylation of eukaryotic elongation factor 2 (eEF2) by cyclin A-cyclin-dependent kinase 2 regulates its inhibition by eEF2 kinase,” Molecular and Cellular Biology, vol. 33, no. 3, pp. 596–604, 2013. View at Publisher · View at Google Scholar · View at Scopus
  49. U. Asghar, A. K. Witkiewicz, N. C. Turner, and E. S. Knudsen, “The history and future of targeting cyclin-dependent kinases in cancer therapy,” Nature Reviews Drug Discovery, vol. 14, no. 2, pp. 130–146, 2015. View at Publisher · View at Google Scholar
  50. M. Qiao, P. Shapiro, M. Fosbrink, H. Rus, R. Kumar, and A. Passaniti, “Cell cycle-dependent phosphorylation of the RUNX2 transcription factor by cdc2 regulates endothelial cell proliferation,” The Journal of Biological Chemistry, vol. 281, no. 11, pp. 7118–7128, 2006. View at Publisher · View at Google Scholar · View at Scopus
  51. O. Timofeev, O. Cizmecioglu, F. Settele, T. Kempf, and I. Hoffmann, “Cdc25 phosphatases are required for timely assembly of CDK1-cyclin B at the G2/M transition,” The Journal of Biological Chemistry, vol. 285, no. 22, pp. 16978–16990, 2010. View at Publisher · View at Google Scholar · View at Scopus
  52. M. Malumbres and M. Barbacid, “Cell cycle, CDKs and cancer: a changing paradigm,” Nature Reviews Cancer, vol. 9, no. 3, pp. 153–166, 2009. View at Publisher · View at Google Scholar · View at Scopus