Table of Contents Author Guidelines Submit a Manuscript
BioMed Research International
Volume 2016 (2016), Article ID 5962028, 10 pages
http://dx.doi.org/10.1155/2016/5962028
Research Article

Heterologous, Expression, and Characterization of Thermostable Glucoamylase Derived from Aspergillus flavus NSH9 in Pichia pastoris

1Department of Molecular Biology, Faculty of Resource Science and Technology, Universiti Malaysia Sarawak, 94300 Kota Samarahan, Sarawak, Malaysia
2Institute of Nutrition and Food Science, University of Dhaka, Dhaka 1000, Bangladesh
3Department of Biochemistry and Molecular Biology, University of Rajshahi, Rajshahi 6205, Bangladesh

Received 2 May 2016; Revised 17 June 2016; Accepted 19 June 2016

Academic Editor: Pengjun Shi

Copyright © 2016 Kazi Muhammad Rezaul Karim et al. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

Supplementary Material

Supplementary Figure 1: In the isolation of glucoamylase gene from both the cDNA and genomic DNA, GAAsp_F (5′CGCATGCGGAACAACCTTCTTT 3′) and GAAsp_R (5′CTACCACGACCCAACAGTTGG 3′) primer set successfully amplified the full length of glucoamylase gene which was recorded as 1482 bp from cDNA and 1587 bp from gDNA, respectively. Figure 1 indicated the full length of PCR products of glucoamylase gene from both the cDNA and gDNA.

Supplementary Figure 2: Five motifs: AEPKF, WGRPQRDGP, DLWEEV, ALSNHK and AAELLYDA were found to be highly conserved among fungi glucoamylase. The first 17 amino acids were presumed to be the signal peptide. Thus, the mature glucoamylase1 protein should consist of 476 amino acids with a calculated molecular weight of 50.746 kDa and isoelectric point of 4.76. Five putative asparagine-linked N-glycosylation sites (at 139,198, 255, 369 and 457 position) and another two possible glycosylation site at 120 and 384) were present in the deduced amino acid sequence, which were deduced according to the rule of Asn-X-Thr/Ser. Searches of protein sequences in the NCBI (Protein BLAST) revealed that the sequence of A. flavus NSH9 glucoamylase 1 (GA1) showed a high degree of similarity with the glucoamylase sequences from other fungal glucoamylases. Figure 2 indicating the coding sequence of glucoamylase 1(GA1) of both the nucleotides and proteins.

  1. Supplementary Figures