Table 1: Primers information [43].

PrimerForward primer sequence 5′ to 3′ (N)Reverse primer sequence 5′ to 3′ (N)

ALU-C4GGTTAGGTATAGTGGTTTATATTTGTAATTTTAGTA (-36)ATTAACTAAACTAATCTTAAACTCCTAACCTCA (-33)
ALU-M1ATTATGTTAGTTAGGATGGTTTCGATTTT (-29)CAATCGACCGAACGCGA (-17)
LINE-1-M1GGACGTATTTGGAAAATCGGG (-21)AATCTCGCGATACGCCGTT (-19)
SAT-α-M1TGATGGAGTATTTTTAAAATATACGTTTTGTAGT (-34)AATTCTAAAAATATTCCTCTTCAATTACGTAAA (-33)