Tracking the Origin and Deciphering the Phylogenetic Relationship of Porcine Epidemic Diarrhea Virus in Ecuador

Table 1

Primers used for amplification of whole S gene and sequencing of PEDV/Cotopaxi/2014.

Primer	Sequence 5′-3′	Nucleotide position	Tm°C	Purpose	Product size (bp)
S5F	TCTTCTGGCGTAATTCCACA	20408–20427	56.86	Amplification (fragment 1)	1216
S1220R	TGAGCCTTCAGCAAGAATGA	21623–21604	57.13
S621F	GGCCCCACTGCTAATAATGA	21024–21043	57.34	Amplification (fragment 2)	1399
S2019R	TGGTACAGGCACTAGCCAAA	22422–22403	58.94
S1441F	TCAATGGGTTTGGATACTTGC	21844–21864	56.49	Amplification (fragment 3)	1391
S2831R	TCCATCACCATTAAACGAACT	23234–23214	55.22
S2219 F	TTCTAGCTTTTTGGCAGGTG	22622–22641	56.24	Amplification (fragment 4)	1409
S3627R	CATCACCACCACAAAAACCA	24030–24011	56.73
DPS3045 F	GGTGTTGTTGACGCTGAGAA	23448–23467	58.7	Amplification (fragment 5)	1377
DP4421R	TGACAACTGTGTCAATCGTGT	24824–24804	58.1
426R	GGCCAGCACAGTACCAAGTT	20829–20810	58.7	Sequencing	-
1220R	TGAGCCTTCAGCAAGAATGA	21623–21604	60.54	Sequencing	-
3045F	GGTGTTGTTGACGCTGAGAA	23448–23467	57.13	Sequencing	-

The position of nucleotide corresponding to PED strain GenBank accession number KM392227.