BioMed Research International / 2017 / Article / Tab 2

Research Article

Screening and Expression of a Silicon Transporter Gene (Lsi1) in Wild-Type Indica Rice Cultivars

Table 2

Primers used to verify the transgenic MR219, MR220, and MR276 plants.

GeneForward primer (5′-3′)Reverse primer (5′-3′)PCR product size

Lsi1ATGGCCAGCAACAACTCGTCACACTTGGATGTTCTC897 bp
CaMV35SCCGACAGTGGTCCCAAAGATTACTCATTTTACTTCTTCG1198 bp