Table 2: Primers used to verify the transgenic MR219, MR220, and MR276 plants.

GeneForward primer (5′-3′)Reverse primer (5′-3′)PCR product size

Lsi1ATGGCCAGCAACAACTCGTCACACTTGGATGTTCTC897 bp
CaMV35SCCGACAGTGGTCCCAAAGATTACTCATTTTACTTCTTCG1198 bp