Table 3: Primers used for real-time qRT-PCR of Lsi1 and two reference genes (18S rRNA and α-Tubulin).

GeneForward 5′ → 3′Reverse 5′ → 3′

Lsi1ATGGCCAGCAACAACTCGTCACACTTGGATGTTCTC
18S rRNAATGATAACTCGACGGATCGCCTTGGATGTGGTAGCCGTTT
α-TubulinGGAAATACATGGCTTGCTGCTTTCTCTTCGTCTTGATGGTTGCA