Research Article
Role of luxS in Stress Tolerance and Adhesion Ability in Lactobacillus plantarum KLDS1.0391
| Primer name | Sequence (5′-3′) | Annealing temperature (°C) | Function |
| luxS-L-f | CCGCTCGAGCGGTTTATCCCACT | 57 | Amplification of luxS left-flanking gene | luxS-L-r | AGCTTTGTTTAAACATTGCCCGTTATT |
| luxS-R-f | GAGCTCGGTGTACGCAAAGTCGT | 63 | Amplification of luxS right-flanking gene | luxS-R-r | GGAAGATCTAATTCCATGTTCACCAGC |
| pNZ5319-L-f | GAGCAGAATGTCCGAGAC | 55 | Identification of double-digested products | pNZ5319-L-r | CGGCTAAAACGACCTTAA |
| pNZ5319-luxS-f | TGTTGCCGATTCCGCTAG | 55 | Identification of double-digested products | pNZ5319-luxS-r | ACCCCGTCAGCTTTAGG |
| luxSqs-f | GTGAAAACGGTGGTGAGGTC | 60 | Identification of luxS gene mutant | luxSqs-r | TCTTTATGTGCTTTGAGCAATA |
|
|