|
| Symbol | Official full name | Physiological functions | Accession numbers | Primer sequence (forward/reverse) | Products size (bp) |
|
| gapdh | Glyceraldehyde-3-phosphate dehydrogenase | An enzyme that catalyzed the sixth step of glycolysis, a process in which glucose is converted to pyruvate. | NM_001001303 | F:catggccttccgtgttccta
R:gcggcacgtcagatcca | 55 [28–30] |
| actb | Beta-actin | Protein plays a key role in cell motility and cytoskeletal maintenance i.e. the structure and integrity. | NM_007393 | F:atgtggatcagcaagcagga
R:aagggtgtaaaacgcagctca | 99 [31] |
| ubc | Ubiquitin C | Protein coded genes are involved in DNA repair and cell cycle regulation. | NM_019639.4 | F:ccagtgttaccaccaagaag
R:acccaagaacaagcacaagg | 94 |
| eef1a1 | eukaryotic translation elongation factor 1 alpha 1 | Translation elongation factor | NM_010106 | F:tccgattacgacgatgttga
R:agtcgccttggacgttctt | 125 [32] |
| b2m | Beta -2 microglobulin | This gene encodes serum protein found on MHC class I on the surface of all nucleated cells. | NM_009735 | F:ttcagtatgttcggcttccc
R:tggtgcttgtctcactgacc | 103 [33, 34] |
| rplp0 | Ribosomal protein lateral stalk subunit P0 | It is a neutral phosphoprotein at the C-terminal end of ribosomal phosphoproteins | NM_007475 | F:ccgatctgcagacacacact
R:accctgaagtgctcgacatc | 91 [35] |
| ywhaz | tyrosine 3-monooxygenase/tryptophan 5-monooxygenase
activation protein, zeta | A central hub protein for many signal transduction pathways and is a major regulator of apoptotic pathways. | NM_011740 | F:ctttctggttgcgaagcatt
R:ttgagcagaagacggaaggt | 148 |
| hmbs | hydroxymethylbilane synthase | Providing instruction for making the enzyme hydroxymethylbilane synthase. | NM_013551 | F:cagggtacaaggctttcagc
R:cggagtcatgtccggtaac | 149 [36] |
| gusb | β-glucuronidase | Providing instruction for producing an enzyme called beta- glucuronidase. | NM_010368 | F:actcctcactgaacatgcga
R:ataagacgcatcagaagccg | 96 [37] |
| ppia | Peptidyl prolyl isomerase A | Cyclosporin binding protein /Inhibitor of serine threonine phosphatase | NM_008907 | F:cagtgctcagagctcgaaagt
R:gtgttcttcgacatcacggc | 109 [38] |
| tbp | TATA box binding protein | Providing an instruction for making TAXA box binding proteins. | NM_013684 | F:ggggtcataggagtcattgg
R:catctcagcaacccacacag | 127 [39] |
| alas1 | δ-Aminolevulinate synthase 1 | catalyzing the first step of heme biosynthesis | NM_020559 | F:gtctgtgccatctgggactc
R:ctgtccacatcagctgtcca | 119 |
| hprt1 | Hypoxanthine phosphoribosyltransferase 1 | providing instructions for producing an enzyme called hypoxanthine phosphoribosyl transferase 1 | NM_013556 | F:cataacctggttcatcatcgc
R:tcctcctcagaccgctttt | 95 [40] |
| tfrc | transferrin receptor | This gene encodes a cell surface receptor necessary for cellular iron uptake by the process of receptor-mediated endocytosis. | NM_011638 | F:gcaccaacagctccaaagtc
R:ccagtgtgggaacaggtctt | 133 [41] |
| ctnnb1 | catenin (cadherin associated protein), beta 1 | The key function of this protein is to mediate the canonical Wnt signaling pathway, regulate gene transcription and mediate cell-cell adhesion | NM_007614.3 | F: gtgcgctgagcttcaggt
R: tcagctcgtgtcctgtgaag | 147 |
| robo4 | Roundabout guidance receptor 4 | Robo4 is a vascular-specific receptor. | NM_028783.3 | F:cagcctggttagctcttctgatg
R:gcacgagcaaagtgagtatcagc | 57 [42] |
| notch1 | Notch homolog 1 | It plays a role in a variety of developmental processes by controlling cell fate decisions | NM_008714.3 | F:ttcgtgctcctgttctttgtg
R:gggctctctccgcttcttc | 129 |
|
