BioMed Research International / 2018 / Article / Tab 1

Research Article

The Antimicrobial Peptide Nal-P-113 Exerts a Reparative Effect by Promoting Cell Proliferation, Migration, and Cell Cycle Progression

Table 1

List of primer sequences used for RT-PCR.

Gene namePrimer (5′-3′)Product size (bp)

FGF2F: 5′ AAGAGCGACCCTCACATCA 3′147
R: 5′ AAAGAAACACTCATCCGTAACAC 3′
TGF-β1F: 5′ AAACCCACAACGAAATCTATGA 3′280
R: 5′ AACCACTGCCGCACAACT 3′
EGFF: 5′ GCTGCTCACTCTTATCAT 3′283
R: 5′ TCTTTCTAAATCCACCC 3′
18s2F: 5′ GAAACGGCTACCACATCC 3′167
R: 5′ ACCAGACTTGCCCTCCA 3′

We are committed to sharing findings related to COVID-19 as quickly as possible. We will be providing unlimited waivers of publication charges for accepted research articles as well as case reports and case series related to COVID-19. Review articles are excluded from this waiver policy. Sign up here as a reviewer to help fast-track new submissions.