Research Article
Two Transcripts of FBXO5 Promote Migration and Osteogenic Differentiation of Human Periodontal Ligament Mesenchymal Stem Cells
Table 1
Primer sequences used in this study.
| Gene | Primer pairs | Primer sequence (5′~3′) | GeneBank accession number |
| FBXO5 | Sense | cgctgtaattcacctgcaaa | NM_001142522.2 NM_012177.4 | Antisense | gaggagcttgccatctgaac | FBXO5 Transcript a | Sense | gggctgagattaggacttgc | NM_001142522.2 | Antisense | agtccggaatgaacatggtt | FBXO5 Transcript b | Sense | gctggcgccttttaagagat | NM_012177.4 | Antisense | cacttcattttgacagaaagggt | GAPDH | Sense | gcaccgtcaaggctgagaac | NG_007073 | Antisense | tggtgaagacgccagtgga |
|
|