BioMed Research International / 2018 / Article / Tab 1

Research Article

Prevalence and Antibiotic Resistance Patterns of Campylobacter spp. Isolated from Broiler Chickens in the North of Tunisia

Table 1

Primers sequence used for Campylobacter spp. identification and expected amplicon sizes.

SpeciesGeneSequence (5/3)Amplicon (bp)References

C. spprRNAGGATGACACTTTTCGGAGC-
CATTGTAGCACGTGTGTC
816Linton et al. 1996

C. jejunimapACTATTTTATTTTTGAGTGCTTGTG
GCTTTATTTGCCATTTGTTTTATTA
589Stucki et al. 1995

C. coliceuEAATTGAAAATTGCTCCAACTATG
TGATTTTATTATTATTTGTAGCAGCG
462Gonzalez et al. 1997

We are committed to sharing findings related to COVID-19 as quickly and safely as possible. Any author submitting a COVID-19 paper should notify us at help@hindawi.com to ensure their research is fast-tracked and made available on a preprint server as soon as possible. We will be providing unlimited waivers of publication charges for accepted articles related to COVID-19.