Table 1: Primers used in this study.

GenesGenBankPrimer sequence (5′-3′)Primer sequence (3′-5′)

GAPDHNM_018007CTGAGGACCAGGTTGTCTCCGAGGGCCTCTCTCTTGCTCT
ASTNM_018172TCAATATGGGGACAATACACTACTTTCTTCATTTCCACCTT
ALTNM_018109TGTATGAAAGTGCTCAAGATGCCCTCTTGTGAGTATAAGT
CKNM_018081CGAACTACTTTATGCCCGAAGACAAACGAGGTCTCTA
LDHNM_001890TATCGAGTCGAGTACGCCAAGTGTGGGACTTTTCCATCAAA