Table 2: Primers used for quantitative assessment of H3 or H4 histone acetylation by PCR following chromatin immunoprecipitation (ChIP).

GeneForward primerReverse primer

CD14ATCAGGGTTCACAGAGGAGACCCCAAGACCCTACAC

FOXP3ATCGTGAGGATGGATGCATTAATACCACTGGGAAGGTCCCTAGC

HDAC4CTCAACACAAGCCTCCCAAGGTGAGGGTGTGGGGTGTAG

IFNGAATCCCACCAGAATGGCACAGGTGGAACAATGTGCTGCACCTCCTCTGG

IL13TGTGGGAGATGCCGTGGGTCTGACTCCCAGAAGTCTGC

RPL32GGAAGTGCTTGCCTTTTTCCGGATTGCCACGGATTAACAC

SH2B3TTGAGTGGGTGGGGCTAAAGCCTACCAATCCCGCTAGTCC