BioMed Research International / 2019 / Article / Tab 1

Research Article

VEGF Induce Vasculogenic Mimicry of Choroidal Melanoma through the PI3k Signal Pathway

Table 1

Primers for real-time PCR.

GenesPrimer sequence

VEGF-S5′ GTGCCCACTGAGGAGTCCAACATC 3′
VEGF-AS5′  GAGCAAGGCCCACAGGGATTTT  3′
AKT-S5′  GACGGGCACATTAAGATCACAGACTTCGG  3′
AKT-AS5′  AAGGGCAGGCGACCGCACATCA  3′
MT1-MMP-S5′  GGGACTGAGGAGGAGACGGAGGTGA  3′
MT1-MMP-AS5′  CAGCAGGGAACGCTGGCAGTAGAG  3′
MMP2-S5′  AACTACGATGATGACCGCAAGTGGG  3′
MMP2-AS5′  GAAGTTCTTGGTGTAGGTGTAAATGGGTG
3′MMP9-S5′  TGCCAGTTTCCATTCATCTTCCAAGGC 3′
MMP9-AS5′  CATCACCGTCGAGTCAGCTCGGGTC 3′
GAPDH-S5′  ATGACATCAAGAAGGTGGTGAAGCAGG  3′
GAPDH-AS5′  GCGTCAAAGGTGGAGGAGTGGGT  3′

We are committed to sharing findings related to COVID-19 as quickly and safely as possible. Any author submitting a COVID-19 paper should notify us at help@hindawi.com to ensure their research is fast-tracked and made available on a preprint server as soon as possible. We will be providing unlimited waivers of publication charges for accepted articles related to COVID-19. Sign up here as a reviewer to help fast-track new submissions.