Table 1: Primers used for qRT-PCR.

PrimersSequence (5′-3′)

CircRNA_011190-RT-FAGGAAAATGACAACTATTACGGCA
CircRNA_011190-RT-RTCCCGGGAGTATCTGGTCTG
CircRNA_014301-RT-FAGAATGAGTCGCTCCTGCAC
CircRNA_014301-RT-RAGTACCGCTTGGCATGTGAG
CircRNA_000793-RT-FGCCCCGATTTCTTTTACCGC
CircRNA_000793-RT-RTGGAGGTCTGACTGCAGGTT
CircRNA_31436-RT-FTCACCAAGGACAAGGGAGGA
CircRNA_31436-RT-RCAGGAGAGGGTCTGGAGGAT
CircRNA_008695-RT-FAGGAGGACAATGAAGCGCC
CircRNA_008695-RT-RTCCCCATTGACACACAAGCA
CircRNA_001731-RT-FTGTCCTCACTGTGACTACGC
CircRNA_001731-RT-RCTCCCGATGGTGTCTCTCCA
CircRNA_017447-RT-FGGCTCATCTGGTCGACCTTC
CircRNA_017447-RT-RCTCTCCCTATGCACACCACG
CircRNA_008565-RT-FAGGAGAAGAGCGTTGCTTGG
CircRNA_008565-RT-RTGTAAGAATCCTGGCGGCTC
CircRNA_011560-RT-FAGGTGGCAGAATCAGGTGTG
CircRNA_011560-RT-RTGTTGTAACTCCCCAGAGCG
CircRNA_24828-RT-FATCTGCAGCTACGAGTGTCG
CircRNA_24828-RT-RACCGGTGAGAGTTTCTCCCT
Rat GAPDH-RT-FACAGCAACAGGGTGGTGGAC
Rat GAPDH-RT-RTTTGAGGGTGCAGCGAACTT