BioMed Research International / 2019 / Article / Tab 2

Research Article

Inhibition of the Nrf2-TrxR Axis Sensitizes the Drug-Resistant Chronic Myelogenous Leukemia Cell Line K562/G01 to Imatinib Treatments

Table 2

Target and control sequences established.

Sequence

Frame structureU6-vshRNA-CMV-GFP

A framework to be established5′-CCGG + sense strand + loop CTCGAG + antisense strand + TTTTTG-3′
5′-AATTCAAAAA + sense strand + loop CTCGAG + antisense strand-3′

Targeted sequence (Nrf2-RNAi-LV)Sense strand siRNA: CCGGCATTTCACTAAACACAA
Antisense strand siRNA: TTGTGTTTAGTGAAATGCCGG

Control sequence (NC-GFP-LV)Target sequence: TTCTCCGAACGTGTCACGT