Research Article
Inhibition of the Nrf2-TrxR Axis Sensitizes the Drug-Resistant Chronic Myelogenous Leukemia Cell Line K562/G01 to Imatinib Treatments
Table 2
Target and control sequences established.
| | Sequence |
| Frame structure | U6-vshRNA-CMV-GFP |
| A framework to be established | 5′-CCGG + sense strand + loop CTCGAG + antisense strand + TTTTTG-3′ | 5′-AATTCAAAAA + sense strand + loop CTCGAG + antisense strand-3′ |
| Targeted sequence (Nrf2-RNAi-LV) | Sense strand siRNA: CCGGCATTTCACTAAACACAA | Antisense strand siRNA: TTGTGTTTAGTGAAATGCCGG |
| Control sequence (NC-GFP-LV) | Target sequence: TTCTCCGAACGTGTCACGT |
|
|