BioMed Research International / 2019 / Article / Tab 1

Research Article

Stable Reference Gene Selection for RT-qPCR Analysis in Synechococcus elongatus PCC 7942 under Abiotic Stresses

Table 1

Primer sequences and amplicon characteristics in the candidate reference genes.

Gene symbolCYORF IDDefinitionPrimer sequence (5′→3′)AmpliconTmE (%)R2Median Ct
(Forward/Reverse)length (bp)(°C)

16SSynpcc 7942_R005216S ribosomal RNAF: GCAAGCCTGACGGAGCAAC1805896.30.9979.13
R: CGGACGCTTTACGCCCAAT
petBSynpcc 7942_2331cytochrome b6F: CTGATCCGCTCCATCCACC2965890.40.99920.88
R: GTTGCCTGACCGACGCTTT
ppcSynpcc 7942_2252phosphoenolpyruvate carboxylaseF: CCCTTGCCAGGACCAGATGA2196296.70.99925.83
R: CGTCGGGTGAGCGGTGAAAA
ilvDSynpcc 7942_0626dihydroxy-acid dehydrataseF: CGGCGCTGCGGCTCAATAT1285897.40.99924.09
R: ATCATCGGCGGCGACAACC
prsSynpcc 7942_2113ribose-phosphate pyrophosphokinaseF: TCTTGCCCTACTACGGTTACGC1025891.10.99924.70
R: TCGCTCCAGCCTGAGTGATTAG
rnpASynpcc 7942_1615ribonuclease P protein componentF: CTCGTTGCCATCGACTGCG13062940.99626.93
R: CGACTTTCGTTGACGGACTCTATTT
rnpBSynpcc 7942_R0036RNA component of RNasePF: TACCGCCGATGGCCTGCTT11958105.10.99816.15
R: TGTCCCTCCACCTTGCTCCC
secASynpcc 7942_0289preprotein translocase, SecA subunitF: ACGACGGTCAGATTGCCGAGAT20459.197.60.99824.97
R: GCGACATTCCCTGCTGGATTAG
rimMSynpcc 7942_225916S rRNA processing protein RimMF: TGATTGACCAAGCCAGCAGCAC1216296.20.99724.88
R: GCCTCCACAAAGGGAATGTAGACC

Article of the Year Award: Outstanding research contributions of 2020, as selected by our Chief Editors. Read the winning articles.