BioMed Research International / 2019 / Article / Tab 1

Research Article

UHRF1 Promotes Proliferation of Human Adipose-Derived Stem Cells and Suppresses Adipogenesis via Inhibiting Peroxisome Proliferator-Activated Receptor γ

Table 1

Primer sequences used for RT-qPCR.

Gene nameprimer sequence(5’-3’)

UHRF15’- GCCATACCCTCTTCGACTACG -3’
5’- GCCCCAATTCCGTCTCATCC -3’
C/EBPα5’-TGGACAAGAACAGCAACGAG-3’
5’-TTGTCACTGGTCAGCTCCAG-3’
PPARγ5’- GAGAAGACTCAGCTCTAC-3’
5’- CAAGCATGAACTCCATAGTG-3’
FABP45’-AGCACCATAACCTTAGATGGGG-3’
5’- CGTGGAAGTGACGCCTTTCA-3’
GAPDH5’-GGCTGAGAACGGGAAGCTTGTCAT-3’
5’-CAGCCTTCTCCATGGTGGTGAAGA-3’

We are committed to sharing findings related to COVID-19 as quickly and safely as possible. Any author submitting a COVID-19 paper should notify us at help@hindawi.com to ensure their research is fast-tracked and made available on a preprint server as soon as possible. We will be providing unlimited waivers of publication charges for accepted articles related to COVID-19. Sign up here as a reviewer to help fast-track new submissions.